bacD

bacD
168

alanine-anticapsin ligase

locus
BSU_37710
Molecular weight
52.10 kDa
pI
4.68
Protein length
Gene length
function
biosynthesis of the antibiotic bacilysin
product
alanine-anticapsin ligase
essential
no
ec
6.3.2.28
synonyms
bacD, ywfE, ipa-83d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0439

This gene is a member of the following regulons

Gene
Coordinates
3,870,668  3,872,086
Phenotypes of a mutant
a ''bacD'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
The protein
Catalyzed reaction/ biological activity
ligation of anticapsin to L-Ala to form bacilysin, ultimate step in bacilysin biosynthesis [Pubmed|23317005]
ATP + L-alanine + L-anticapsin --> ADP + bacilysin + H+ + phosphate (according to UniProt)
[wiki|Domains]
[wiki|ATP-grasp doamin] (aa 142-355) (according to UniProt)
Structure
[PDB|3VMM] [Pubmed|22407814]
[AF|P39641]
Expression and Regulation
Operons
genes
[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
description
[Pubmed|12372825]
regulation
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots [pubmed|34557426]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12372825,21709425], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|12697329,21709425], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|19801406], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|19801406], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]→[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]

2022-11-26 19:33:48

Jstuelk

45

7D644717829C1A41F65E52A4312081846FB55951

33F4BF1A14F6AC22A6ACC7091140A7F012E3837C

Biological materials
Mutant
MGNA-B241 (ywfE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1240 NBRP B. subtilis, Japan]
BKE37710 ([gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCCATATGTAAAACACTCC,  downstream forward: _UP4_ACGGCAAAGTATGTGCTGCC
BKK37710 ([gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37710 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCCATATGTAAAACACTCC,  downstream forward: _UP4_ACGGCAAAGTATGTGCTGCC
References
16030213,12372825,19352016,19801406,21948839,22407814,24702628,23317005,12697329,21709425,22298000,26296725

2CE0C0484A70EEE40277996CD3D564A84FEAF5B3

Page visits: 2145

Time of last update: 2022-11-27 04:00:57

Author of last update: Melvin.boenninger