yfkJ

yfkJ
168

general stress protein, protein tyrosine phosphatase, required for protection against paraquat stress

locus
BSU_07880
Molecular weight
17.13 kDa
pI
4.56
Protein length
Gene length
function
survival of stress conditions
product
protein tyrosine phosphatase
essential
no
ec
3.1.3.48
synonyms
yfkJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0394

This gene is a member of the following regulons

Gene
Coordinates
862,004  862,474
The protein
Catalyzed reaction/ biological activity
H2O + O-phospho-L-tyrosyl-[protein] --> L-tyrosyl-[protein] + phosphate (according to UniProt)
Protein family
low molecular weight phosphotyrosine protein phosphatase family (with [protein|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC] and [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE], according to UniProt)
Structure
[PDB|4ETM]
[AF|O35016]
Paralogous protein(s)
[protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]
Expression and Regulation
Operons
genes
[gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]-[gene|A38D85EE1BCCA5E5E77CAF9583E7D052BB7F8188|yfkI]-[gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]
description
[Pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528,11532142]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11532142], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,11532142], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]→[gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]

2022-11-27 07:42:57

Jstuelk

22

414988eb39ed35bf7e943cad2a5639654c38211e

02A1CA317676092BC72B700F05F049C865AA2EF5

Biological materials
Mutant
MGNA-C266 (yfkJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2264 NBRP B. subtilis, Japan]
BKE07880 ([gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGCAACCTCCCTA,  downstream forward: _UP4_TTGTGAGTGAAAGGAGAATT
BKK07880 ([gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGTGCAACCTCCCTA,  downstream forward: _UP4_TTGTGAGTGAAAGGAGAATT
References
15866923,15995210,22582280,15805528,11532142

2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167

Page visits: 2877

Time of last update: 2022-12-01 09:33:41

Author of last update: Melvin.boenninger