SubtiWiki SubtiWiki
dtrR

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

dtrR
168

D-Tyr resistance regulator ([wiki|MarR family])

locus
BSU_38450
Molecular weight
19.50 kDa
pI
8.76
Protein length
Gene length
function
resistance to D-Tyr
product
transcription factor ([wiki|MarR family])
essential
no
synonyms
dtrR, ywaE, ipa-10r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
3,946,394  3,946,909
The protein
Catalyzed reaction/ biological activity
repression of the ''[gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]-[gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]'' operon [Pubmed|25733610]
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 33-166) (according to UniProt)
Structure
[PDB|3CDH] (from Silicibacter pomeroyi, 24% identity)
Expression and Regulation
Operons
genes
[gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]-[gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]
description
[Pubmed|25733610]
regulation
induced by tyrosine limitation ([protein|search|T-box]) [Pubmed|25733610,19258532,1735721]
regulatory mechanism
[protein|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]: repression, [Pubmed|25733610], in [regulon|protein:2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR regulon]
T-box: anti-termination, in [regulon|other_regulator:T-box|T-box]
sigma factors
[protein|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]: sigma factor, [Pubmed|1735721], in [regulon|protein:1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ regulon]
Open in new tab

[gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]→[gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]

2021-10-03 06:26:32

ghost

2

74b2f4d2d40be21d04649012c98c32ffad1c5306

AE76E703ABACEA6477FFDE49A728A198DC210002

Biological materials
Mutant
MGNA-B219 (ywaE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1218 NBRP B. subtilis, Japan]
BKE38450 ([gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTAGGCCTGCCTTA,  downstream forward: _UP4_GCTGACAATCTTCATACAAC
BKK38450 ([gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTAGGCCTGCCTTA,  downstream forward: _UP4_GCTGACAATCTTCATACAAC
References
25733610

2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6

Page visits: 1399

Time of last update: 2022-01-20 04:57:17

Author of last update: Melvin.boenninger