nasA

nasA
168

nitrate transporter

locus
BSU_03330
Molecular weight
45.91 kDa
pI
10.49
Protein length
Gene length
function
nitrate uptake
product
nitrate transporter
essential
no
synonyms
nasA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2223

This gene is a member of the following regulons

Gene
Coordinates
362,937  364,142
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Nitrate/nitrite porter (TC 2.A.1.8) family (with [protein|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK], according to UniProt)
Structure
[PDB|4U4T] (NarK from E. coli, 24% identity) [pubmed|25959928]
[AF|P42432]
Paralogous protein(s)
[protein|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]
description
[pubmed|22383849]
regulation
expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]) [Pubmed|8799114]
expression in biofilms is organized in a ring-like pattern [pubmed|34995513]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|8799114], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
Open in new tab

[gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]

2022-08-30 07:01:50

Jstuelk

18

B0A7E499A729606231D0164E24ED59020480AF73

2D645BBEFA05233706DD7C3927A64A8C32C3A1C2

Biological materials
Mutant
1A972 ( ''nasA''::''phleo''), [Pubmed|7868621], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A972&Search=1A972 BGSC]
BKE03330 ([gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCCCCTTTCTAG,  downstream forward: _UP4_TAGGATTTTGACGGACACGC
BKK03330 ([gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCCCCTTTCTAG,  downstream forward: _UP4_TAGGATTTTGACGGACACGC
References
Reviews
22103536,11289299
Original Publications
7836289,12823818,25755103,8799114,7868621,25959928,34995513

2DE7BEC614129384779F4C761E0792385DECC563

Page visits: 1475

Time of last update: 2022-10-03 02:18:13

Author of last update: Jstuelk