ybgB

ybgB
168

putative immunity protein

locus
BSU_02380
Molecular weight
10.14 kDa
pI
8.47
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybgB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5658

This gene is a member of the following regulons

Gene
Coordinates
258,532  258,807
The protein
Structure
[AF|O31460]
Paralogous protein(s)
[protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|sdpI], [protein|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]
description
[Pubmed|12897008]
regulation
induced by glucosamine ([protein|search|gamR]) [Pubmed|24673833,23667565]
regulatory mechanism
[protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]: repression, [Pubmed|24673833,23667565], in [regulon|protein:FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23667565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY]: sigma factor, [Pubmed|12897008], in [regulon|protein:801E92306971E26AD4AB155172B7F4EFDE2F9170|sigY regulon]
Open in new tab

[gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]

2022-11-25 02:40:40

ghost

21

aa150d8f4048e97710523ec752be2e95bb6f7642

58B24A562E28D5C27BC0F9F8FB90BED534B72519

genes
[gene|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]-[gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]
description
[Pubmed|23667565]
regulation
induced by glucosamine ([protein|search|gamR]) [Pubmed|24673833,23667565]
induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
regulatory mechanism
[protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]: repression, [Pubmed|24673833,23667565], in [regulon|protein:FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|23667565], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]→[gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]

2022-11-27 21:13:27

ghost

33

23ad24e5d0f0ebe864f8ce62d459ff58ea2562d9

E34905CD5A79F10FB8D4BF3FBA89AF47E5096F33

Biological materials
Mutant
BKE02380 ([gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCACCATTCCCTT,  downstream forward: _UP4_TAAATCAAACAGCCAGAATA
BKK02380 ([gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCACCATTCCCTT,  downstream forward: _UP4_TAAATCAAACAGCCAGAATA
References
12897008,24673833,23667565

2E0FBCA66FB88EDFD345FA289F776C7CA23976F5

Page visits: 1764

Time of last update: 2022-11-27 02:06:50

Author of last update: Melvin.boenninger