SubtiWiki SubtiWiki
yfnB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfnB
168

putative [wiki|HAD superfamily] phosphatase

locus
BSU_07330
Molecular weight
27.23 kDa
pI
4.63
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfnB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1011

This gene is a member of the following regulons

Gene
Coordinates
804,657  805,364
The protein
Protein family
[wiki|HAD superfamily] (according to UniProt)
Structure
[PDB|3ED5]
Paralogous protein(s)
[protein|50417B2FA0ED2258A13B1E708514F055297599EF|serB]
Expression and Regulation
Operons
genes
[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]-[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]
description
[Pubmed|22383849]
Open in new tab

[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]→[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]

2022-01-23 23:04:37

Jstuelk

4

b6b78bb6887a7ceaf2f3c3e8eeafcaa8ecfb4296

3386852116AAF37D19BAA57D64A70CDF2C264211

genes
[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]
description
[pubmed|22383849]
Open in new tab

[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]

2022-01-25 10:51:32

Jstuelk

4

443964a3e8fd508f7f3509491efd21980e77a581

F5AD031741C4AD51B5CF7AFA5A679BA21A8FCFA4

Biological materials
Mutant
MGNA-C327 (yfnB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2325 NBRP B. subtilis, Japan]
BKE07330 ([gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGTGTCTCCCTTTC,  downstream forward: _UP4_TAATCAGGCTGACGGTATTT
BKK07330 ([gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGTGTCTCCCTTTC,  downstream forward: _UP4_TAATCAGGCTGACGGTATTT

2E1E22349750C3EE9B6575EED30A82ED0D5F07F0

Page visits: 689

Time of last update: 2022-01-26 17:22:47

Author of last update: Melvin.boenninger