ndoA

ndoA
168

RNase EndoA, MazF family toxin, UACAU-specific mRNA interferase

locus
BSU_04660
Molecular weight
12.84 kDa
pI
4.89
Protein length
Gene length
function
unknown
product
mRNA interferase
essential
no
synonyms
ndoA, ydcE, mazF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2337

This gene is a member of the following regulons

Gene
Coordinates
518,943  519,293
The protein
Catalyzed reaction/ biological activity
specifically cleaves a five-base sequence, UACAU [Pubmed|21763692]
Protein family
PemK/MazF family (single member, according to UniProt)
Structure
[PDB|1NE8] [Pubmed|14517982]
[PDB|4MDX] (NdoA-RNA) [Pubmed|24120662]
[PDB|4ME7] ([protein|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]-[protein|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI] complex) [Pubmed|24120662]
[AF|P96622]
Effectors of protein activity
the activity is inhibited by the interaction with [protein|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI] [Pubmed|17416361]
Expression and Regulation
Operons
genes
[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
description
[Pubmed|15882409]
additional information
An [wiki|ncRNA] is predicted for '[protein|search|ndoA]' [PubMed|20525796]
Open in new tab

[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]→[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]

2022-11-21 00:33:55

ghost

13

7f8a7dc2f7eaf781e947a6a63979c438df7e04e3

5DFE68AF98CACE6494FDB04249DEF62EF29E68F8

genes
[gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr]-[gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]-[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]
description
[pubmed|22383849]
Open in new tab

[gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr]→[gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]

2022-11-17 22:22:57

Jstuelk

22

91b7fa89916159e2bc7894e263572f1eeb4a5554

F1ED0F7D4D8E54352AA236431B9C138B1FC5ADBA

Biological materials
Mutant
BKE04660 ([gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCGCCGCGTTTCACAATCA,  downstream forward: _UP4_TAGACATATTTGCAGGTTGC
BKK04660 ([gene|2E5A557E417CB355331CC0555D46A79793EB90B3|ndoA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATCGCCGCGTTTCACAATCA,  downstream forward: _UP4_TAGACATATTTGCAGGTTGC
References
15882409,17416361,20525796,21763692,21897862,23378533,14517982,24120662,24489751,23736285,28017721

2E5A557E417CB355331CC0555D46A79793EB90B3

Page visits: 2595

Time of last update: 2022-12-01 09:40:14

Author of last update: Melvin.boenninger