map

map
168

methionine aminopeptidase

locus
BSU_01380
Molecular weight
27.26 kDa
pI
6.39
Protein length
Gene length
function
removal of N-terminal methionine from nascent proteins
product
methionine aminopeptidase
essential
no
ec
3.4.11.18
synonyms
map, mapA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0024 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
146,527  147,273
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides (according to UniProt)
Protein family
peptidase M24A family (with [protein|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG], according to UniProt)
Structure
[PDB|1O0X] (from Thermotoga maritima, 50% identity) [pubmed|15211524]
[PDB|2MAT] (from ''Escherichia coli'', 46% identity, 65% similarity) [Pubmed|10387007]
[AF|P19994]
Paralogous protein(s)
[protein|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]
description
NULL
regulation
[protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
strongly expressed
Open in new tab

[gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]→[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]

2025-10-26 18:32:29

ghost

161

0fcb68b7a6ea4a1daf5330728804c5d02a1c9715

678D7FB850B7A0788F1455D46D0FCE6D548E5CD2

genes
[gene|751D0B909922D4D931FF3B2285CF142D966FCD48|rpsJ]-[gene|FEF94BD8482A41C493A8BEC3278B518E8BB4EDFE|rplC]-[gene|02F0893E814E00187D7B342990838EE5445CA78B|rplD]-[gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW]-[gene|9445AC486A2B0A025030B275C789D227D5694145|rplB]-[gene|5287063586EB218843451386108E45274C7A8D68|rpsS]-[gene|F3DE42C41EF57DC5DFFF0D28129F2CE5DB781D99|rplV]-[gene|E7F4E01A6005C8469EAC64E8DFED96D0F29791A9|rpsC]-[gene|C5CAED1256F082E722EBA0A72647AA043B5681DB|rplP]-[gene|49B6E673E28CF21DF629B90A6AD453C46822BDB0|rpmC]-[gene|657A76B7786DC44861ECAC8FDFC8B4E8B55EF05F|rpsQ]-[gene|2BE91EEB70A1961D3BBE0603648E64E86CD0B708|rplN]-[gene|7E4159B8999B33370B12C18AFE2455507DEF891C|rplX]-[gene|F34C72BF4C3A8FF710D3B65F87324400ECDE3610|rplE]-[gene|0CC562884650F322298BEA28C889E2ABCB01AFDE|rpsN]-[gene|B50A96DCD3E8FB26BBC2819DA11A6E0B040C1C8E|rpsH]-[gene|20485A785D3AF82889F2018D3EA5B5FA33E64E95|rplF]-[gene|B39056862596254F3EC7AB2466B6FB3634621DF0|rplR]-[gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE]-[gene|87741B91E3081B7CC1C8AF275B38A52C066F018C|rpmD]-[gene|BEACD74FE0AE56E8154F3EB8D4247488030BF0D3|rplO]-[gene|5350DC618130E013757EE667B9AFC5F2EC68EC08|secY]-[gene|DD3A39A84E53A9B2ACBDD89DFAE3560E45C08DC1|adk]-[gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]-[gene|15EAA4007484D9F82CF4F402FF156165156FDDDE|oapB]-[gene|BFAF497FB8E871AA84A0864CB08D2059791C7E73|infA]-[gene|F69B475C014087C6DEBE2F50F91862A623D21D1E|rpmJ]-[gene|C8B2EC9E35BDE4FC9B5642B8169F4BD13ACD30AC|rpsM]-[gene|8F83D1839E63016E2FA599A756A161DA5476D4D1|rpsK]-[gene|8B9957188874E9A20D2490730BA216F813D48F36|S56]-[gene|5996A5C25E108A3C4562686BF34A59CB14FD56EB|rpoA]-[gene|0D210B61B8F58DA21D97CFDE441501E31AB50D00|rplQ]
description
[Pubmed|9371452]
regulation
strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
likely autorepression of operon expression upon binding of excess of one ribosomal protein to the untranslated region of the mRNA [Pubmed|17616982]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
Open in new tab

[gene|751D0B909922D4D931FF3B2285CF142D966FCD48|rpsJ]→[gene|0D210B61B8F58DA21D97CFDE441501E31AB50D00|rplQ]

2025-10-26 14:34:04

Jstuelk

209

911D53E804EEFE6335D6A0F79722F9870F387CD3

9027854E648E8BF3E4A3C8492D350C69AC71C218

Biological materials
Mutant
BKE01380 ([gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA,  downstream forward: _UP4_TAGATGATGAAAATAATTCC
BKK01380 ([gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA,  downstream forward: _UP4_TAGATGATGAAAATAATTCC
References
16207374,8635744,23770820,28189581,15211524

2F2455E189FC61A6B1EC6B66412FC662E44BD3F6

Page visits: 6969

Time of last update: 2025-10-29 21:59:41

Author of last update: Jstuelk