

methionine aminopeptidase

Molecular weight
27.26 kDa
Protein length
Gene length
removal of N-terminal methionine from nascent proteins
methionine aminopeptidase
map, mapA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0024

This gene is a member of the following regulons

146,527  147,273
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides (according to UniProt)
Protein family
peptidase M24A family (with [protein|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG], according to UniProt)
[PDB|2MAT] (from ''Escherichia coli'', 46% identity, 65% similarity) [Pubmed|10387007]
Paralogous protein(s)
cytoplasm (according to Swiss-Prot)
Expression and Regulation
[protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
strongly expressed
Open in new tab


2022-12-01 17:23:37





strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
likely autorepression of operon expression upon binding of excess of one ribosomal protein to the untranslated region of the mRNA [Pubmed|17616982]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
Open in new tab


2022-11-28 03:45:49





Biological materials
BKE01380 ([gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA,  downstream forward: _UP4_TAGATGATGAAAATAATTCC
BKK01380 ([gene|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|map]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTCACGTGGGGTTTTACAGA,  downstream forward: _UP4_TAGATGATGAAAATAATTCC


Page visits: 2544

Time of last update: 2022-12-01 09:19:19

Author of last update: Melvin.boenninger