pdhC

pdhC
168

pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit)

locus
BSU_14600
Molecular weight
47.38 kDa
pI
4.86
Protein length
Gene length
function
links glycolysis and TCA cycle
product
pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit)
essential
no
ec
2.3.1.12
synonyms
pdhC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0508

This gene is a member of the following regulons

Gene
Coordinates
1,530,537 1,531,865
Phenotypes of a mutant
defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]
poor growth [pubmed|28189581]
non-transformable [pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
(R)-N6-dihydrolipoyl-L-lysyl-[protein] + acetyl-CoA --> (R)-N6-(S8-acetyldihydrolipoyl)-L-lysyl-[protein] + CoA (according to UniProt)
Protein family
[wiki|2-oxoacid dehydrogenase family] (according to UniProt)
[wiki|Domains]
[wiki|Lipoyl-binding domain] (aa 2-77) (according to UniProt)
[wiki|Peripheral subunit-binding domain] (PSBD) (aa 141-178) (according to UniProt)
[wiki|Cofactors]
lipoic acid (on Lys-43), can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN] [pubmed|28900027]
Structure
[PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus''), [PDB|2PDE] (peripheral subunit binding domain, ''Geobacillus stearothermophilus''), [PDB|1LAC] (lipoyl domain, ''Geobacillus stearothermophilus''), [PDB|1B5S] (catalytic domain (residues 184-425) , ''Geobacillus stearothermophilus'')
[AF|P21883]
Modification
phosphorylated (Ser/Thr/Tyr) [Pubmed|17726680]
Effectors of protein activity
Inhibited by thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
Low sensibility to NADPH
Kinetic information
Michaelis-Menten [Pubmed|6414463]
Paralogous protein(s)
[protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
[wiki|Localization]
membrane associated [Pubmed|18763711]
cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]-[gene|458E967052D1093A0F48AE0E6B6CCA0F52EAC44D|pdhB]-[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]-[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]
description
[Pubmed|11976308]
regulation
''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
regulatory mechanism
stringent response: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20081037], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|pdhA]→[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]

2022-05-25 21:55:04

ghost

19

797fea7dcbe4317f63eb94d44165272d12ff3ae4

3D5EA61F84C1F6538A394D4F9A00FD4029ED115F

genes
[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]-[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]
description
[Pubmed|11976308]
regulation
''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
Open in new tab

[gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]→[gene|E9BBAE86DF3E536A987179CC394B472F6F710498|pdhD]

2022-04-27 17:28:19

ghost

13

22b57c718f31ad11fe44c3a9b66c0348a0c6dcab

F1C43D78FC4D596937F2D6B16CB47827D858EE6D

Biological materials
Mutant
BKE14600 ([gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTCTCGACCTCCTAG, downstream forward: _UP4_TTAATTTTAATGGAGGCGTA
BKK14600 ([gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTCTCGACCTCCTAG, downstream forward: _UP4_TTAATTTTAATGGAGGCGTA
labs
[wiki|Arthur Aronson], Purdue University, West Lafayette, USA [http://wwwdev.gradschool.purdue.edu/PULSe/faculty.cfm?fid=5&range=0 homepage]
References
Reviews
19476487,9655937,2227213,6805383,1794583,24798336,27074917
Original Publications
9352926,24825009,9352926,17726680,12850135,18763711,6414463,11976308,20081037,22862776,15378759,28900027,28189581,31066113

2F40086E35FA32136B9A89C530A86D714FE9460C

Page visits: 2473

Time of last update: 2022-06-25 08:06:57

Author of last update: Melvin.boenninger