ntdA

ntdA
168

pyridoxal phosphate-dependent 3-oxo-glucose-6-phosphate:glutamate aminotransferase

locus
BSU_10550
Molecular weight
49.98 kDa
pI
5.97
Protein length
Gene length
function
synthesis of the antibiotic kanosamine
product
pyridoxal phosphate-dependent
essential
no
synonyms
ntdA, yhjL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0399

This gene is a member of the following regulons

Gene
Coordinates
1,128,286  1,129,611
The protein
Catalyzed reaction/ biological activity
3-oxo-d-glucose-6-phosphate + glutamate --> kanosamine-6-phosphate [Pubmed|23586652]
Protein family
DegT/DnrJ/EryC1 family (with [protein|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN] and [protein|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC], according to UniProt)
[wiki|Cofactors]
pyridoxalphosphate [Pubmed|23586652]
Structure
[PDB|4K2I] [Pubmed|24097983]
[AF|O07566]
Expression and Regulation
Operons
genes
[gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]
description
[Pubmed|17056753]
regulation
induced by 3,3'-neotrehalosadiamine and kanosamine ([protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]) [Pubmed|33619155,14612444]
regulatory mechanism
[protein|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]: activation , in [regulon|protein:9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14612444], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]→[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]

2022-12-01 01:32:27

Jstuelk

27

41B772604ED3B8BA7F5F0AFF19B989A8E4F9FDC1

2A657E0F29C43EAF1C8F99F810D2B0756ABA88B3

Biological materials
Mutant
MGNA-A725 (yhjL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/725 NBRP B. subtilis, Japan]
BKE10550 ([gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE10550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAACAGTACCTCCAATG,  downstream forward: _UP4_TTTCATGTTATTAAGCAAGA
BKK10550 ([gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK10550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAACAGTACCTCCAATG,  downstream forward: _UP4_TTTCATGTTATTAAGCAAGA
References
Reviews
21512256
Original Publications
19087206,19342798,17056753,14612444,23586652,24097983,32786294,33619155,34096710

2F850E2DFA6287DB3890243803E06FDE7ACDB10E

Page visits: 1543

Time of last update: 2022-11-29 01:52:30

Author of last update: Jstuelk