SubtiWiki SubtiWiki
yddJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yddJ
168

ICEBs1 exclusion factor, protects the donor cells from cell death after conjugation

locus
BSU_04990
Molecular weight
14.54 kDa
pI
4.52
Protein length
Gene length
function
prevention of redundant transfer of ICEBs1 into host cells that already contain a copy of the element
product
ICEBs1 exclusion factor
essential
no
ec
null
synonyms
yddJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
545,595  545,975
The protein
[wiki|Localization]
putative lipoprotein, attached to the cell membrane [pubmed|31361051]
Expression and Regulation
Operons
genes
[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
description
[pubmed|22383849]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]

2022-01-01 14:52:25

Bzhu

1

aadb88622c1ae3170506bc4fd9885eb1742f82a5

3F9C466366EF0476723C6CDA65655A071B0F1713

genes
[gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|devI]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
description
[pubmed|22383849]
regulatory mechanism
[protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]: repression, [Pubmed|17511812], in [regulon|protein:DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR regulon]
Open in new tab

[gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]->[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]

2022-01-24 01:15:08

Bzhu

8

9225e26ee70027d168e8ea0db13fb48c93ef1ef8

DE8D2BDC2F23AB45C58B0FE511E7B4816A65A489

Biological materials
Mutant
BKE04990 ([gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATAAACATTACCTCCT,  downstream forward: _UP4_TAAACCGTGTGTTTACTCCT
BKK04990 ([gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04990 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATAAACATTACCTCCT,  downstream forward: _UP4_TAAACCGTGTGTTTACTCCT
References
20817675,31361051,33649151

2FB1C9435AE924F8E450AFA81F800196A871F2D0

Page visits: 1158

Time of last update: 2022-01-22 18:54:24

Author of last update: Jstuelk