SubtiWiki SubtiWiki
aag
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

aag
168

hypoxanthine-DNA glycosylase, general stress protein, required for protection against paraquat stress

locus
BSU_38620
Molecular weight
21.98 kDa
pI
6.12
Protein length
Gene length
function
DNA repair, survival of stress conditions
product
hypoxanthine-DNA glycosylase
essential
no
synonyms
aag, yxlJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2094

This gene is a member of the following regulons

Gene
Coordinates
3,964,278  3,964,868
Phenotypes of a mutant
increased sensitivity of sporulating cells to the genotoxic effects of MMS [Pubmed|27698084]
The protein
Catalyzed reaction/ biological activity
removes hypoxanthine, 3-alkylated purines, and 1,N6-ethenoadenine from DNA; hypoxanthine and 1,N6-ethenoadenine are the preferred substrates [Pubmed|14729667]
protects sporulating cells from cytotoxic and genotoxic effects of MMS [Pubmed|27698084]
Protein family
DNA glycosylase MPG family (single member, according to UniProt)
Structure
[PDB|3QI5] (the human enzyme in complex with DNA, 33% identity) [pubmed|21349833]
[wiki|Localization]
forespore [Pubmed|27698084]
Expression and Regulation
Operons
genes
[gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]-[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]
description
[Pubmed|8990303]
regulation
expressed late during [wiki|sporulation] in the forespore [wiki|SigG] [Pubmed|27698084]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|27698084], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]→[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]

2021-08-21 06:16:54

ghost

4

2e8b672555f6a425e250bf03a974e94656637507

136A388E58BFB19B9852E8EAEF40166A3E0CCE89

Biological materials
Mutant
MGNA-B756 (yxlJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1755 NBRP B. subtilis, Japan]
BKE38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT,  downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
BKK38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT,  downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
References
Reviews
22933559
Original Publications
15805528,14729667,22582280,27698084,21349833

305DCA94A69BCF64E377F142722A035871A3B824

Page visits: 1060

Time of last update: 2021-09-22 13:46:07

Author of last update: Melvin.boenninger