aag

aag
168

hypoxanthine-DNA glycosylase, general stress protein, required for protection against paraquat stress

locus
BSU_38620
Molecular weight
21.98 kDa
pI
6.12
Protein length
Gene length
function
DNA repair, survival of stress conditions
product
hypoxanthine-DNA glycosylase
essential
no
synonyms
aag, yxlJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2094

This gene is a member of the following regulons

Gene
Coordinates
3,964,278  3,964,868
Phenotypes of a mutant
increased sensitivity of sporulating cells to the genotoxic effects of MMS [Pubmed|27698084]
The protein
Catalyzed reaction/ biological activity
removes hypoxanthine, 3-alkylated purines, and 1,N6-ethenoadenine from DNA; hypoxanthine and 1,N6-ethenoadenine are the preferred substrates [Pubmed|14729667]
protects sporulating cells from cytotoxic and genotoxic effects of MMS [Pubmed|27698084]
Protein family
DNA glycosylase MPG family (single member, according to UniProt)
Structure
[PDB|3QI5] (the human enzyme in complex with DNA, 33% identity) [pubmed|21349833]
[AF|P94378]
[wiki|Localization]
forespore [Pubmed|27698084]
Expression and Regulation
Operons
genes
[gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]-[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]
description
[Pubmed|8990303]
regulation
expressed late during [wiki|sporulation] in the forespore [wiki|SigG] [Pubmed|27698084]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|27698084], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]→[gene|9A30DA670D03D63C59DEB54EA7BD6DCEDDBD561A|yxzF]

2023-02-02 14:09:59

ghost

29

2e8b672555f6a425e250bf03a974e94656637507

136A388E58BFB19B9852E8EAEF40166A3E0CCE89

Biological materials
Mutant
MGNA-B756 (yxlJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1755 NBRP B. subtilis, Japan]
BKE38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT,  downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
BKK38620 ([gene|305DCA94A69BCF64E377F142722A035871A3B824|aag]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38620 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGAATCGACCTCTCCTTT,  downstream forward: _UP4_TAGCATGTTTAAGGAAGAGG
References
Reviews
22933559
Original Publications
15805528,14729667,22582280,27698084,21349833

305DCA94A69BCF64E377F142722A035871A3B824

Page visits: 1291

Time of last update: 2023-02-04 20:10:35

Author of last update: Melvin.boenninger