nprE

nprE
168

extracellular neutral protease B

locus
BSU_14700
Molecular weight
56.35 kDa
pI
7.48
Protein length
Gene length
function
degradation of proteins
product
extracellular neutral protease B
essential
no
synonyms
nprE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3227

This gene is a member of the following regulons

Gene
Coordinates
1,540,036  1,541,601
The protein
Catalyzed reaction/ biological activity
Similar, but not identical, to that of thermolysin (according to UniProt)
Protein family
peptidase M4 family (with [protein|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB], according to UniProt)
Structure
[PDB|1NPC] (of ''Bacillus cereus'')
[AF|P68736]
Paralogous protein(s)
[protein|57139471EB143F6DCCF092DAD0FBB43B0D50D948|nprB]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]
description
[pubmed|22383849]
regulation
repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]) [Pubmed|1906467]
regulatory mechanism
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|1906467], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|26728191], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
additional information
in a triple ''[wiki|abrB] [wiki|codY] [wiki|scoC]'' mutant, expression occurs during exponential growth [Pubmed|26728191]
Open in new tab

[gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]

2022-11-27 09:22:43

Jstuelk

12

21d1f270954b2d8d94674be59c72eb511d58de04

94DA6F9BF205BFF8F5A4278010F0A27C973DBFCD

Biological materials
Mutant
KO7 (''nprE  aprE  epr  mpr  nprB  vpr  bpr''), available as BGSC 1A1133
BKE14700 ([gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAATAAATCCCCCTTTTT,  downstream forward: _UP4_TAATATTAGGAAAAGCCTGA
BKK14700 ([gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAATAAATCCCCCTTTTT,  downstream forward: _UP4_TAATATTAGGAAAAGCCTGA
References
Reviews
34410368
Original Publications
1906467,18957862,20817675,24115457,26728191

309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF

Page visits: 3355

Time of last update: 2022-11-27 11:18:19

Author of last update: Jstuelk