yraF

yraF
168

forespore-specific sporulation protein, similar to spore coat protein

locus
BSU_26960
Molecular weight
13.87 kDa
pI
5.14
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yraF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5577

This gene is a member of the following regulons

Gene
Coordinates
2,753,065  2,753,433
The protein
Protein family
[wiki|CotF family] (according to UniProt)
Structure
[AF|O07949]
[wiki|Localization]
spore wall (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]→[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]

2023-02-05 08:41:10

ghost

47

d7b65b29af87b17d60d957745dbcb60005e27aaf

1230FD48E94D5C4C5D5DC8D83656D0C540213821

Biological materials
Mutant
MGNA-A028 (yraF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/28 NBRP B. subtilis, Japan]
BKE26960 ([gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCAAAGAGGCTTACCTCC,  downstream forward: _UP4_CACTAACACTGGAGGTTTTA
BKK26960 ([gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCAAAGAGGCTTACCTCC,  downstream forward: _UP4_CACTAACACTGGAGGTTTTA
References
16497325

30A4306899B586898BC5B3666AD43D9DEE0579E1

Page visits: 1766

Time of last update: 2023-02-02 17:42:25

Author of last update: Melvin.boenninger