SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


similar to transcriptional regulator ([wiki|MarR family])

Molecular weight
16.70 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

4,109,185  4,109,616
The protein
Protein family
[wiki|MarR family]
[wiki|HTH marR-type domain] (aa 11-139) (according to UniProt)
Expression and Regulation
Open in new tab


2021-08-28 05:23:22





Biological materials
MGNA-B761 (yxaD::erm), available at the [ NBRP B. subtilis, Japan]
BKE40010 ([gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGCTCTCGCTCCCTAT,  downstream forward: _UP4_TAACAGCTGAAAAACCCATG
BKK40010 ([gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGCTCTCGCTCCCTAT,  downstream forward: _UP4_TAACAGCTGAAAAACCCATG


Page visits: 742

Time of last update: 2022-01-21 02:17:57

Author of last update: Melvin.boenninger