yxaD

yxaD
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_40010
Molecular weight
16.70 kDa
pI
6.76
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yxaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
4,109,185  4,109,616
The protein
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 11-139) (according to UniProt)
Structure
[AF|P42103]
Expression and Regulation
Operons
genes
[gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]
description
[Pubmed|10746760]
Open in new tab

[gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]

2022-06-18 17:43:37

ghost

7

41a07bca22d55ddd591d8d0f8927e0765c42e52a

280503004FBCBA1D3A2CC0C7ED16E4EF310B01E0

Biological materials
Mutant
MGNA-B761 (yxaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1760 NBRP B. subtilis, Japan]
BKE40010 ([gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGCTCTCGCTCCCTAT,  downstream forward: _UP4_TAACAGCTGAAAAACCCATG
BKK40010 ([gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40010 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATCGCTCTCGCTCCCTAT,  downstream forward: _UP4_TAACAGCTGAAAAACCCATG
References
16479537,10746760

30E52226538965F2AF1EC34F5E4A14CA8B4CDE26

Page visits: 855

Time of last update: 2022-06-28 03:53:20

Author of last update: Melvin.boenninger