yebA

yebA
168

unknown

locus
BSU_06350
Molecular weight
75.18 kDa
pI
8.96
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yebA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1305

This gene is a member of the following regulons

Gene
Coordinates
690,364  692,577
Phenotypes of a mutant
defective in [category|SW.4.1.4|Swarming] motility (prolonged period of immotility prior to [category|SW.4.1.4|Swarming]) [pubmed|35638827]
The protein
Structure
[PDB|6G49] (from Pseudomonas aeruginosa, corresponds to aa 375 ... 550, 35% identity) [pubmed|30599211]
[AF|P94476]
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-A917 (yebA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/917 NBRP B. subtilis, Japan]
BKE06350 ([gene|30EAEE67EFEF41366ADBAD6BACFFC1933539866D|yebA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAACCAGTCACCTCT,  downstream forward: _UP4_TGACCGCTTATCGACGTGTT
BKK06350 ([gene|30EAEE67EFEF41366ADBAD6BACFFC1933539866D|yebA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK06350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAACCAGTCACCTCT,  downstream forward: _UP4_TGACCGCTTATCGACGTGTT
References
Research papers
30599211,35638827

30EAEE67EFEF41366ADBAD6BACFFC1933539866D

Page visits: 1275

Time of last update: 2022-10-03 13:48:21

Author of last update: Jstuelk