fadB

fadB
168

3-hydroxyacyl-CoA dehydratase

locus
BSU_28540
Molecular weight
27.40 kDa
pI
4.95
Protein length
Gene length
function
fatty acid degradation
product
3-hydroxyacyl-CoA dehydratase
essential
no
ec
4.2.1.17
synonyms
fadB, ysiB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1024

This gene is a member of the following regulons

Gene
Coordinates
2,917,166  2,917,942
The protein
Catalyzed reaction/ biological activity
(3S)-hydroxyacyl-CoA --> (2E)-enoyl-CoA + H2O (according to UniProt)
4-saturated-(3S)-hydroxyacyl-CoA --> (3E)-enoyl-CoA + H2O (according to UniProt)
Protein family
[wiki|enoyl-CoA hydratase/isomerase family] (according to UniProt)
Structure
[PDB|3PEA] (from ''B. anthracis'', 49% identity, 66% similarity)
[AF|P94549]
Modification
phosphorylated on Arg-230 [Pubmed|22517742]
Paralogous protein(s)
[protein|25B45D6A90AD5152FDA71718B14767EA86ECA15B|yhaR], (34%)
Expression and Regulation
Operons
genes
[gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]-[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
description
[Pubmed|17189250]
regulation
induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]) [Pubmed|17189250]
regulatory mechanism
[protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]: repression, [Pubmed|17189250], in [regulon|protein:8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|21398533], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|21398533], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|7AC5217CA35F8E134ABB35D74F1BA5E684D2E058|lcfA]→[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]

2022-12-29 17:58:40

Jstuelk

25

d18d49394aac4cec0002a2695f8ea4b1c4cda4f5

DEE7D2778BB88C7028C79F5FEDED5CD757497033

genes
[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]-[gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]-[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]-[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]
description
[Pubmed|17189250]
regulation
induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
Open in new tab

[gene|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|fadR]→[gene|ACA8FF923D72CC99F447E47F6A1381FEAD9DAB09|etfA]

2022-12-29 17:58:43

ghost

25

079c8f1574d2e1a8270f558e4ec0295a90806447

FA5DAFE8C700F246311EFDCE5474D8DD396BEC38

Biological materials
Mutant
MGNA-B009 (ysiB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1008 NBRP B. subtilis, Japan]
1A854 ( ''fadB''::''cat''), [Pubmed|17085570], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A854&Search=1A854 BGSC]
BKE28540 ([gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCATTCATAGGACAGAACT,  downstream forward: _UP4_GGCGAATAAAAGGGGATATG
BKK28540 ([gene|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|fadB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCATTCATAGGACAGAACT,  downstream forward: _UP4_GGCGAATAAAAGGGGATATG
References
12850135,17189250,17919287,22517742

3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8

Page visits: 3276

Time of last update: 2023-02-06 20:34:40

Author of last update: Melvin.boenninger