ycsI

ycsI
168

unknown

locus
BSU_04070
Molecular weight
28.68 kDa
pI
6.41
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycsI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4336

This gene is a member of the following regulons

Gene
Coordinates
459,049  459,822
The protein
Protein family
D-glutamate cyclase family (single member, according to UniProt)
Structure
[PDB|3DB9] (from Agrobacterium tumefaciens, 57% identity)
[AF|P42966]
Expression and Regulation
Operons
genes
[gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
description
[Pubmed|9334321]
regulation
induced in the presence of 5-oxoproline [pubmed|28830929]
regulatory mechanism
[protein|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]: repression, [Pubmed|9334321], in [regulon|protein:7DA9A79876C546B78B716A64706A3A3716018C2E|kipR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|9334321], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
Open in new tab

[gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]→[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]

2022-11-21 22:48:37

Jstuelk

27

2e345e8dee0849e85fe094a123ef62dc61c60b82

B227AB4ADF5839F5D85D0A01462013A7CDA6A81D

Biological materials
Mutant
MGNA-C023 (ycsI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2021 NBRP B. subtilis, Japan]
BKE04070 ([gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTTAATTGCTCCA,  downstream forward: _UP4_TAGCCTCTCGTCATCCTGAT
BKK04070 ([gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04070 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTTAATTGCTCCA,  downstream forward: _UP4_TAGCCTCTCGTCATCCTGAT
References
9334321,25755103

312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA

Page visits: 1077

Time of last update: 2022-12-01 00:49:29

Author of last update: Melvin.boenninger