ydaD

ydaD
168

general stress protein, similar to alcohol dehydrogenase

locus
BSU_04190
Molecular weight
30.93 kDa
pI
4.78
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydaD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1028

This gene is a member of the following regulons

Gene
Coordinates
471,709  472,569
The protein
Protein family
[wiki|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
Structure
[PDB|3I30] (from ''Bacillus Anthracis'', 61% identity)
[AF|P80873]
Paralogous protein(s)
[protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF], [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]
[protein|439B468A13137000FB42E9389391CB4986FFED84|fabG], (31.1%)
[protein|4DEFC2998464BF8327578C36A13A10DD277F991E|ykvO], (37.5%),
[protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|yhxC], (63,5%)
[protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|yhxD], (48,8%)
[protein|B6FF689E65906186F3576B378650D713DB84EDDA|ycdF], (69%)
[protein|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh], (35,8%)
[protein|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|yjdA], (33,3%)
[protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD], (36.7%)
[protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC] (34.3%), [protein|439B468A13137000FB42E9389391CB4986FFED84|fabG] (31.1%), [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|kduD] (36.7%), [protein|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]
Expression and Regulation
Operons
genes
[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]
description
[Pubmed|22383849]
regulation
induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [pubmed|15805528,10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]→[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]

2022-11-28 14:51:29

Jstuelk

19

4fb2a110a5d336e59c462730f404e23690d89eac

7BAF2B4B190B99035F090F954FC6468528A7BBF8

genes
[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
description
[Pubmed|10220166]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]→[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]

2022-11-29 14:15:58

ghost

27

0f01f3d4a72c13fc2bd8814fcb16a6972198e29f

A2B50F578CB3D7FDB3773EE82697C8F07A97C986

Biological materials
Mutant
MGNA-C086 (ydaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2084 NBRP B. subtilis, Japan]
BKE04190 ([gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCTCCTCCTTT,  downstream forward: _UP4_ACGACATAAGAGGGAGTGAG
BKK04190 ([gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCTCCTCCTTT,  downstream forward: _UP4_ACGACATAAGAGGGAGTGAG
References
10220166,15805528,23033921

3161519994609DA9360ED6E073E4A4C8C6210EFB

Page visits: 2078

Time of last update: 2022-12-05 13:35:47

Author of last update: Jstuelk