

[wiki|ABC transporter] (hydrophobic protein, probably channel protein)

Molecular weight
36.80 kDa
Protein length
Gene length
[wiki|ABC transporter] (hydrophobic protein, probably channel protein)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

3,116,996  3,117,982
Visit Visit
The protein
Protein family
ABC-5 integral membrane protein family (with [protein|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD], according to UniProt)
Paralogous protein(s)
cell membrane (according to UniProt)
Expression and Regulation
expressed early in the stationary phase [Pubmed|10986249]
regulatory mechanism
[protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]: repression, [Pubmed|10986249,21856850], in [regulon|protein:6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-04-20 21:32:59





Biological materials
GP3189 (Δ[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]), available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
GP3205 Δ([gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD])::''cat'', available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
MGNA-B539 (ytrC::erm), available at the [ NBRP B. subtilis, Japan]
BKE30440 ([gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]::erm  trpC2) available at [ BGSC] and in [wiki|Jörg Stülke]'s lab,  [Pubmed|28189581], upstream reverse: _UP1_CTCTCGATAGAGGAGACCTC,  downstream forward: _UP4_TAAGAAATGCCTTAGGTTTG
BKK30440 ([gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTCTCGATAGAGGAGACCTC,  downstream forward: _UP4_TAAGAAATGCCTTAGGTTTG


Page visits: 3986

Time of last update: 2024-04-24 00:59:34

Author of last update: Jstuelk