darA

darA
168

c-di-AMP-binding PII-like protein

locus
BSU_00290
Molecular weight
11.83 kDa
pI
6.09
Protein length
Gene length
function
unknown
product
c-di-AMP-binding PII-like protein
synonyms
darA, yaaQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3870

This gene is a member of the following regulons

Gene
Coordinates
39,871  40,200
Phenotypes of a mutant
inactivation of [gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA] facilitates the adaptation a strain lacking c-di-AMP to growth on complex medium [pubmed|33481774]
The protein
Structure
[PDB|4RLE] (the ''B. subtilis'' protein in complex with c-di-AMP) [Pubmed|25433025]
[AF|P37538]
Effectors of protein activity
binds c-di-AMP [Pubmed|25433025]
Expression and Regulation
Operons
genes
[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]-[gene|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]-[gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO]-[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
description
[Pubmed|22383849]
Open in new tab

[gene|08314FA6195D553B8522BCD3B45FEE0EAB51F64D|xpaC]→[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]

2022-11-24 03:33:18

Jstuelk

80

adcd0181c3bf7f5a66d1644d176d0c60f2121a3a

87CEB0D67D1455F48A42F665A0B9A91B779AEC5D

genes
[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
description
[Pubmed|22383849]
regulation
expressed during growth and the transition phase, expression is erduced in stationary phase [Pubmed|23490197]
Open in new tab

[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]→[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]

2022-11-25 21:07:20

ghost

65

62a125e6301e56c82f6a74dcb70741fe56737f41

DA0A2CE2876D38C223E4BA512D01D105B53BF136

genes
[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]-[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]-[gene|DC867376EF4F9CC7663A9B76AA260AC3CA11595A|holB]-[gene|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|yaaT]-[gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA]-[gene|55C4B4B7B46B6D04EF712BD79407C0B04DDC6A34|trmN6]-[gene|47859E62AABA5A57AC6F5F80CDE4ED52FC7F879F|yazA]-[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]
description
[Pubmed|22383849]
Open in new tab

[gene|5B9984BBCEC1244628DC1467BE26976AD8E06286|tmk]→[gene|FB71FFDEABF17228CA2BD5F3DE0C8A9A2C22485D|yabC]

2022-11-24 19:40:12

Jstuelk

71

cae86a5ed186d19f5321f28f72d35514a5988afb

E9A27179465E2479F141CE804267881CAB860CC2

Biological materials
Mutant
MGNA-B897 (yaaQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1896 NBRP B. subtilis, Japan]
GP1712 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''cat''), available in [wiki|Jörg Stülke]'s lab [Pubmed|25433025]
GP1713 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]-[gene|3422E4C34EAAF355A9767F1AD8DFAE9A6A756F0C|yaaR]''::''cat''), available in [wiki|Jörg Stülke]'s lab
GP2406 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''ermC''), available in [wiki|Jörg Stülke]'s lab
GP2415 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''spc''), available in [wiki|Jörg Stülke]'s lab
GP2497 (''[gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]''::''tet''), available in [wiki|Jörg Stülke]'s lab
BKE00290 ([gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT,  downstream forward: _UP4_CATCAATTTTAAGGATCTGA
BKK00290 ([gene|31C8DCB4E1E225AC92EC2E11835234C4668AB326|darA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00290 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTGTGAAGGCCTCCTTT,  downstream forward: _UP4_CATCAATTTTAAGGATCTGA
Expression vectors
pGP2797: expression of ''darA'' (native RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
pGP3002: expression of ''darA'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
pGP2601: IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844], available in [wiki|Jörg Stülke]'s lab [Pubmed|25433025]
pGP1690: IPTG inducible expression, purification in ''E. coli'' with N-terminal cleavable His-tag, in [wiki|pGP570], available in [wiki|Jörg Stülke]'s lab
pGP2624: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
pGP2602: expression of Strep-''darA'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP2603: expression of ''darA''-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP2847: expression of His6-''darA'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
GP2010: expression of ''darA''-Strep in ''B. subtilis'' (chromosomal), suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
25869574,32095817,32472931,32603625
Original Publications
22383849,25433025,33481774

31C8DCB4E1E225AC92EC2E11835234C4668AB326

Page visits: 4276

Time of last update: 2022-11-28 15:16:06

Author of last update: MBenda