appD

appD
168

oligopeptide [wiki|ABC transporter ](ATP-binding protein)

locus
BSU_11360
Molecular weight
36.16 kDa
pI
5.39
Protein length
Gene length
function
uptake of oligopeptides
product
oligopeptide [wiki|ABC transporter ](ATP-binding protein))
essential
no
synonyms
appD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0444

This gene is a member of the following regulons

Gene
Coordinates
1,211,477  1,212,463
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 5-256) (according to UniProt)
Structure
[PDB|4FWI] (from Caldanaerobacter subterraneus, 38% identity) [pubmed|23385461]
[AF|P42064]
Paralogous protein(s)
[protein|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD], [protein|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD], [protein|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]
[wiki|Localization]
attached to the cell membrane (via [protein|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[protein|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|DD2C5F549759447FF1C30E5B43BCB74CE4320EF3|appA/1]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]
description
[Pubmed|7997159]
regulation
repressed by [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY] [Pubmed|12618455]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|25755103], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [pubmed|12618455] [pubmed|18083814], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC]: repression, [Pubmed|10383984], in [regulon|protein:F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|scoC regulon]
Open in new tab

[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]→[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]

2022-11-30 15:15:06

Jstuelk

37

b46f08a2cd8f8540d1ae7be3ab793fb86c3b4d9c

D515582AF1C173F5A0D9E2C830FC884903502563

Biological materials
Mutant
GP2100 (D(''[gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]-[gene|B88A88B4792FFFF4E1609B1FC91AAE6DBA339044|appF]-[gene|082D2012ABE3671F62211F77ED501849BF77B4EF|appA/2]-[gene|C6EB94EACDA544700A468545BD1FDA91C5FD82FB|appB]-[gene|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|appC]'')::''spc''), available in [wiki|Jörg Stülke]'s lab
BKE11360 ([gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTAGCTCCCCTTTCCC,  downstream forward: _UP4_GAGGAAGAGGGTGCCGAACA
BKK11360 ([gene|325BCDCAB4003204294229B7F9F0A5F353D72B54|appD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTAGCTCCCCTTTCCC,  downstream forward: _UP4_GAGGAAGAGGGTGCCGAACA
References
18083814,12618455,7997159,10092453,10383984,12618455,25755103,23385461

325BCDCAB4003204294229B7F9F0A5F353D72B54

Page visits: 2423

Time of last update: 2022-11-30 15:30:22

Author of last update: Melvin.boenninger