ydgK

ydgK
168

similar to bicyclomycin resistance protein

locus
BSU_05680
Molecular weight
42.52 kDa
pI
10.09
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydgK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
613,641  614,849
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Bcr/CmlA family (single member, according to UniProt)
Structure
[PDB|2GFP] (from E. coli, 28% identity) [pubmed|16675700]
[AF|P96709]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]
description
[Pubmed|22383849]
Open in new tab

[gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]

2022-11-26 06:01:39

Jstuelk

29

b99ba07f63a08ca30c39bc8bb5233d11e6761fb0

2AF726B4BAD0B736EB03289B74D2004D208DDBF4

Biological materials
Mutant
MGNA-C176 (ydgK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2174 NBRP B. subtilis, Japan]
BKE05680 ([gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCAAACCTTCCCT,  downstream forward: _UP4_TAAAAAAACCTGACATGACG
BKK05680 ([gene|327BF988C3D50598DF8F3CEEC62934A44E81767F|ydgK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCAAACCTTCCCT,  downstream forward: _UP4_TAAAAAAACCTGACATGACG
References
Research papers
16675700

327BF988C3D50598DF8F3CEEC62934A44E81767F

Page visits: 1084

Time of last update: 2022-11-26 20:40:15

Author of last update: Melvin.boenninger