lnrL

lnrL
168

similar to [wiki|ABC transporter] (ATP-binding protein), involved in resistance to linearmycin

locus
BSU_08310
Molecular weight
33.95 kDa
pI
6.5
Protein length
Gene length
function
resistance to linearmycin
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yfiL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1131

This gene is a member of the following regulons

Gene
Coordinates
905,816  906,751
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 2-232) (according to UniProt)
Structure
[PDB|4YER] (from Thermotoga maritima, 39% identity)
[AF|P94440]
[wiki|Localization]
membrane associated (via [protein|07858BFC72EB0B6AF615C8D4C8BCC162D8C3E7D2|lnrM]-[protein|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]-[gene|07858BFC72EB0B6AF615C8D4C8BCC162D8C3E7D2|lnrM]-[gene|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN]
description
[Pubmed|26647299]
regulation
expression during spore [wiki|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
induced in the presence of linearmycin and other polyenes ([protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]) [pubmed|28461449]
regulatory mechanism
[protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]: activation, [Pubmed|26647299], in [regulon|protein:387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]→[gene|79BAF2329209C81E8D165F131F9DAADB4A81448A|lnrN]

2022-11-25 06:01:29

Jstuelk

20

7fa1f47baf646398b2d2b81a08036e691ef5d550

3B045C04B4C45662F4875ADEB7A4D524530CAE31

Biological materials
Mutant
MGNA-C354 (yfiL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2352 NBRP B. subtilis, Japan]
BKE08310 ([gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTCGTCTCACTCCTTTT,  downstream forward: _UP4_TTGCGGGATTGAGGAGGGAC
BKK08310 ([gene|329E4DF9EF1545AABE485B9BBCD22F09ABF019A1|lnrL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGTCGTCTCACTCCTTTT,  downstream forward: _UP4_TTGCGGGATTGAGGAGGGAC
References
10092453,26647299,27766092,28461449,32973732

329E4DF9EF1545AABE485B9BBCD22F09ABF019A1

Page visits: 2216

Time of last update: 2022-12-01 09:49:08

Author of last update: Jstuelk