mecA

mecA
168

buffering protein for development, dampens transitions to spore, biofilm exopolysaccharide and competence expression , targets [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] and [protein|4D76F07D6124D56C7CEBBDAB9E84B2718BF1E7FC|comS] to the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] degradation machine (in log phase), inhibits the transcriptional activity of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]-P by direct interaction

locus
BSU_11520
Molecular weight
25.62 kDa
pI
4.21
Protein length
Gene length
function
control of [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] degradation, regulation of competence
product
adaptor protein
essential
no
synonyms
mecA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4862

This gene is a member of the following regulons

Gene
Coordinates
1,229,068  1,229,724
Phenotypes of a mutant
defective in swarming motility (reduced rate of colony expansion) [pubmed|35638827]
The protein
Catalyzed reaction/ biological activity
recruits protein for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] [pubmed|12598648]
inhibits transcription activation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]-P (in complex with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]) [pubmed|29446505]
Protein family
mecA family (with [protein|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH], according to UniProt)
[wiki|Domains]
N-terminal domain (1-120): recruitment of protein substrates [Pubmed|19801546]
C-terminal domain (121-218): facilitates assembly of the [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP] oligomer and acts as a degradation tag [Pubmed|19801546]
Structure
[PDB|3PXG] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|mecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] complex) [pubmed|21368759]
[PDB|3J3U] (the [protein|331993A875907C10C77105FD8DDD86D4412CE405|mecA]-[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] complex) [Pubmed|23595989]
[PDB|3JTP](C-terminal domain) [Pubmed|19801546]
[AF|P37958]
Paralogous protein(s)
[protein|CE1C46944E242006383BA77B2C4E09045CB3B93F|ypbH]
Expression and Regulation
Operons
genes
[gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]
description
[Pubmed|8412687]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8412687], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]

2023-01-23 12:13:26

ghost

23

a7eff32f2142ccd5507e9841a00a021df33d8346

9393514154CA17D711EA90973907CF0CBFF6C1FF

Biological materials
Mutant
GP813 (spc), GP814 (aphA3) both available in [wiki|Jörg Stülke]'s lab
BKE11520 ([gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAACCTTCCCTTC,  downstream forward: _UP4_TAGCAAACCGATTTCCTTCC
BKK11520 ([gene|331993A875907C10C77105FD8DDD86D4412CE405|mecA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11520 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAACCTTCCCTTC,  downstream forward: _UP4_TAGCAAACCGATTTCCTTCC
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
23375660,23479438,19609260,34438398
Original Publications
11914365,9000055,17560370,19361434,9890793,2113920,8817496,8412687,11918817,10447896,12028382,8016067,10361283,11703662,9535081,19767395,19801546,8016066,19202088,8083167,21368759,23595989,16525504,12598648,21435029,29165246,29446505,35638827

331993A875907C10C77105FD8DDD86D4412CE405

Page visits: 3873

Time of last update: 2023-02-05 00:29:02

Author of last update: Christoph.elfmann