gerBA

gerBA
168

nutrient receptor, germination response to the combination of glucose, fructose, and KCl

locus
BSU_35800
Molecular weight
53.62 kDa
pI
7.3
Protein length
Gene length
function
germination response to the combination of glucose, fructose, and KCl
product
nutrient receptor
essential
no
synonyms
gerBA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5901

This gene is a member of the following regulons

Gene
Coordinates
3,688,812  3,690,263
The protein
Protein family
[wiki|GerABKA family] (according to UniProt)
Structure
[PDB|6O59] (from B. megaterium, corresponds to aa 7 ... 264, 36.5% identity) [pubmed|31113879]
[AF|P39569]
Paralogous protein(s)
[protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ], [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD], [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA], [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|gerAA]
[wiki|Localization]
spore inner membrane [Pubmed|21696470]
Expression and Regulation
Operons
genes
[gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]-[gene|D70EC7C02BC79BED724489ABCB6356447F215B87|gerBB]-[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]
description
[Pubmed|8012571]
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,8012571]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,8012571], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
additional information
700 molecules are present per spore [PubMed|23749970]
Open in new tab

[gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]→[gene|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|gerBC]

2022-12-29 20:54:15

ghost

24

11403d1061e669b27b23e28630f92c3f61532965

BDB4DB82BD783DEB3DA0C1C26208AF22202AD946

Biological materials
Mutant
BKE35800 ([gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCTCCTTCTTA,  downstream forward: _UP4_AACATCAGACAAAGGTGATG
BKK35800 ([gene|3368743E6E03792DB83A38A19989123304DF7560|gerBA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTTTCTCTCCTTCTTA,  downstream forward: _UP4_AACATCAGACAAAGGTGATG
References
10348844,12670969,15774895,7812448,11395462,16352818,8012571,21696470,23396907,24752279,16740944,26731423,31113879

3368743E6E03792DB83A38A19989123304DF7560

Page visits: 2290

Time of last update: 2023-02-05 02:33:02

Author of last update: Jstuelk