papA

papA
168

Xaa-Pro amino-peptidase

locus
BSU_24460
Molecular weight
37.96 kDa
pI
4.83
Protein length
Gene length
function
degradation of proline-containing peptides
product
Xaa-Pro amino-peptidase
essential
no
ec
3.4.11.9
synonyms
papA, yqhT

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0006

This gene is a member of the following regulons

Gene
Coordinates
2,538,697  2,539,758
Phenotypes of a mutant
inactivation of ''[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]'' reduces sporulation efficiency to 1.2% that of wild type cells; delayed entry into sporulation [Pubmed|26735940]
The protein
Protein family
peptidase M24B family (with [protein|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB], according to UniProt)
Structure
[PDB|3Q6D] (the ''B. anthracis'' enzyme, 65% identity, 82% similarity)
[AF|P54518]
Paralogous protein(s)
[protein|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|449EEBF33F52B461F244331ACD140E68CF64EE7C|yqhR]-[gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]-[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]-[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]
description
[pubmed|22383849]
Open in new tab

[gene|449EEBF33F52B461F244331ACD140E68CF64EE7C|yqhR]→[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]

2022-11-30 03:27:24

Jstuelk

27

5a3af415b3d477ed26b5a5ba683e8b71aa900cda

4C13A03AFAA21B82D13D48369D7EA262D08E39DE

genes
[gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]-[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]-[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]
description
[pubmed|22383849]
Open in new tab

[gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]→[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]

2022-11-30 06:19:20

Jstuelk

31

04645919ad54957aa4b00016a6391e23f3845b46

AAFB82DFDDF37319D77CE472A297D3AA713E6311

Biological materials
Mutant
MGNA-C447 (yqhT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2445 NBRP B. subtilis, Japan]
available in [wiki|Erhard Bremer]'s lab
BKE24460 ([gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTTGATTCTCCCCC,  downstream forward: _UP4_TGATTGGAATATAGGAGGAC
BKK24460 ([gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTCATCTTGATTCTCCCCC,  downstream forward: _UP4_TGATTGGAATATAGGAGGAC
Expression vectors
pGP769: expression of Strep-''papA'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP1150: expression of ''papA''-Strep by [wiki|pGP382] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Erhard Bremer], Marburg University, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
References
23144141,26735940

33886A1EAC13B684E92BF94201C46617AD2844B3

Page visits: 1532

Time of last update: 2022-12-08 04:31:13

Author of last update: Melvin.boenninger