levB

levB
168

endolevanase

locus
BSU_34460
Molecular weight
58.81 kDa
pI
4.99
Protein length
Gene length
function
levan degradation
product
endolevanase
essential
no
ec
3.2.1.64
synonyms
levB, yveB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1621

This gene is a member of the following regulons

Gene
Coordinates
3,537,507  3,539,057
Phenotypes of a mutant
defective in tomato root colonization in the presence of sucrose [pubmed|33772107]
The protein
Catalyzed reaction/ biological activity
Hydrolysis of (2->6)-beta-D-fructofuranan, to remove successive disaccharide residues as levanbiose, i.e. 6-(beta-D-fructofuranosyl)-D-fructose, from the end of the chain (according to UniProt)
Protein family
glycosyl hydrolase 32 family (with [protein|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC] and [protein|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA], according to UniProt)
Structure
[PDB|4FFF] (from Arthrobacter ureafaciens, 42% identity) [pubmed|22810228]
[AF|O07003]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]-[gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]
description
[Pubmed|11739774]
regulation
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|2428811], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY]: antitermination, /antitermination via binding to a [wiki|RNA switch], in [regulon|protein:EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|sacY regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2428811], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|AAA944BE7F01CE90F7730EECA16F3E4ED77D165A|sacB]→[gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]

2022-11-23 06:26:28

Jstuelk

22

045fcc2eb89a1dc92a1a5a36944dc7ec173ff1cf

738CCB0FCDEF80A5E71672A01EA171EF191FFE25

Biological materials
Mutant
MGNA-B614 (yveB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1613 NBRP B. subtilis, Japan]
BKE34460 ([gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGGGATTCACCTTTAT,  downstream forward: _UP4_TAAAAACAGGGGCGGCGCAG
BKK34460 ([gene|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGGGATTCACCTTTAT,  downstream forward: _UP4_TAAAAACAGGGGCGGCGCAG
References
11739774,2428811,3039303,26773563,22810228,33772107

33BEC05F2129EBAF6699E847B0909A5A48F0E869

Page visits: 2580

Time of last update: 2022-11-29 16:07:23

Author of last update: Jstuelk