yfnC

yfnC
168

similar to fosmidmycin resistance protein

locus
BSU_07320
Molecular weight
43.33 kDa
pI
9.8
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfnC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2271

This gene is a member of the following regulons

Gene
Coordinates
803,317  804,546
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|O06481]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|3416CB670B861D3F4ECFF87AE6E4397F6D7304FE|yfnC]
description
[Pubmed|22383849]
Open in new tab

[gene|3416CB670B861D3F4ECFF87AE6E4397F6D7304FE|yfnC]

2022-11-30 01:27:42

Jstuelk

14

694e74ef96e7e6d5c40fe82cfc6303f53b1bd0f6

42A0908541751478981E23796A8F9D5EF1126F2A

Biological materials
Mutant
MGNA-C326 (yfnC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2324 NBRP B. subtilis, Japan]
BKE07320 ([gene|3416CB670B861D3F4ECFF87AE6E4397F6D7304FE|yfnC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGTCTCCTCCTTACA,  downstream forward: _UP4_TGAAAAAACCCCTGCCAGGC
BKK07320 ([gene|3416CB670B861D3F4ECFF87AE6E4397F6D7304FE|yfnC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07320 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGAGTCTCCTCCTTACA,  downstream forward: _UP4_TGAAAAAACCCCTGCCAGGC

3416CB670B861D3F4ECFF87AE6E4397F6D7304FE

Page visits: 1069

Time of last update: 2022-11-26 19:13:03

Author of last update: Melvin.boenninger