ycbM

ycbM
168

two-component sensor kinase

locus
BSU_02560
Molecular weight
17.85 kDa
pI
9.75
Protein length
Gene length
function
unknown
product
two-component sensor kinase
essential
no
synonyms
ycbM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2205

This gene is a member of the following regulons

Gene
Coordinates
279,059  279,994
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL] (putative)
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine
[wiki|Domains]
[wiki|Histidine kinase domain] (aa 92-310) (according to UniProt)
Structure
[PDB|5C93] ([protein|E88978809272FAC2520DB4ABCA0554F8028F3451|walK] from Lactobacillus plantarum, 27% identity) [pubmed|28994408]
[AF|P42245]
Modification
autophosphorylation on a His residue
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]-[gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]-[gene|FE7AC936BE959D745FBB6A88EAD64408C7177125|ycbN]-[gene|621FA6E2A76BB74F9051FBDB6857ED56F65BAB15|ycbO]
description
[pubmed|22383849]
Open in new tab

[gene|60DA46B02BB5F71337AF5F34921E2E68EC062EC7|ycbL]→[gene|621FA6E2A76BB74F9051FBDB6857ED56F65BAB15|ycbO]

2022-12-01 15:17:23

Jstuelk

18

77090242fa94fd81070f7200512e38f969f10d55

C42DE0C164AE1418C323B42BA4174D5584CA1EA2

Biological materials
Mutant
MGNA-C035 (ycbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2033 NBRP B. subtilis, Japan]
BKE02560 ([gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCGGCCACCCATAGCACTG,  downstream forward: _UP4_TAATCGTAAGAATTTCTTAA
BKK02560 ([gene|348F81B6ECB6FFBEC092A672FF5F40FE86918872|ycbM]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AGCGGCCACCCATAGCACTG,  downstream forward: _UP4_TAATCGTAAGAATTTCTTAA
References
10094672,28994408

348F81B6ECB6FFBEC092A672FF5F40FE86918872

Page visits: 1608

Time of last update: 2022-12-01 12:30:51

Author of last update: Melvin.boenninger