yfhA

yfhA
168

[wiki|ABC transporter] for the siderophore schizokinen and arthrobactin (permease), works with ATPase [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]

locus
BSU_08460
Molecular weight
35.80 kDa
pI
10.26
Protein length
Gene length
function
[wiki|acquisition of iron]
product
[wiki|ABC transporter] for the siderophore schizokinen and arthrobactin (permease)
essential
no
synonyms
yfhA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0609

This gene is a member of the following regulons

Gene
Coordinates
921,472  922,503
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|FecCD subfamily] (according to UniProt)
Structure
[PDB|2NQ2] (complex with [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]-like protein, from Haemophilus influenzae, 33% identity) [pubmed|17158291]
[AF|O31569]
Paralogous protein(s)
[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE], [protein|EC98685EE0E3CE6CE8DC33409481AE96315279AC|fhuG]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|81494D4E7E52531802C3C0D0073739DA9375F5DF|yfiZ]-[gene|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|yfhA]
description
[pubmed|22383849]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [pubmed|12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|81494D4E7E52531802C3C0D0073739DA9375F5DF|yfiZ]->[gene|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|yfhA]

2022-11-23 17:49:49

Bzhu

23

3b90199f6fc557cfa00d16598b68c6cd47fbeaec

0E55ED2EC081643F73E9D03E3A9707F842920087

Biological materials
Mutant
MGNA-C313 (yfhA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2311 NBRP B. subtilis, Japan]
BKE08460 ([gene|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|yfhA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATAGCTTCGCCCCCCT,  downstream forward: _UP4_TAATCGTTACACCCATTTTC
BKK08460 ([gene|34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9|yfhA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATAGCTTCGCCCCCCT,  downstream forward: _UP4_TAATCGTTACACCCATTTTC
References
10092453,16672620,12354229,17158291

34A7E22B4EF118EF5A76F8CC2DABBB023BC9A2E9

Page visits: 1889

Time of last update: 2022-11-28 22:41:37

Author of last update: Melvin.boenninger