ynzJ

ynzJ
168

unknown, putative pseudogene

locus
BSU_17678
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
ynzJ

Genomic Context

Categories containing this gene/protein

This gene is a member of the following regulons

Gene
Coordinates
1,901,612  1,901,737
Biological materials
Mutant
BKE17678 ([gene|34FA6237AD1D888F869A128A241B4AC60C1CF8C9|ynzJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17678 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATATTCTTCAATGAGAA,  downstream forward: _UP4_TGAACCGCTGCCAAATATCA
BKK17678 ([gene|34FA6237AD1D888F869A128A241B4AC60C1CF8C9|ynzJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17678 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAATATTCTTCAATGAGAA,  downstream forward: _UP4_TGAACCGCTGCCAAATATCA

34FA6237AD1D888F869A128A241B4AC60C1CF8C9

Page visits: 734

Time of last update: 2022-06-27 11:12:49

Author of last update: Bzhu