tcyL

tcyL
168

cystine [wiki|ABC transporter] (permease)

locus
BSU_29360
Molecular weight
26.09 kDa
pI
9.3
Protein length
Gene length
function
cystine uptake
product
cystine [wiki|ABC transporter] (permease)
essential
no
synonyms
tcyL, ytmL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0765

This gene is a member of the following regulons

Gene
Coordinates
3,005,859  3,006,578
The protein
Protein family
[wiki|Binding-protein-dependent transport system permease family] (according to UniProt)
[wiki|Domains]
[wiki|ABC transmembrane type-1 domain] (aa 21-216) (according to UniProt)
Structure
[PDB|4YMS] (amino acid transporter from Caldanaerobacter subterraneus, 31% identity) [pubmed|25848002]
[AF|O34315]
Paralogous protein(s)
[protein|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|yxeN]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
description
[Pubmed|15668000]
regulation
induced in the presence of methionine and taurine [Pubmed|11390694]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: repression, [Pubmed|16109943], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
[protein|741156D495BE3857683C8A0390764EAD83845ABC|ascR]: activation, [Pubmed|16109943], in [regulon|protein:741156D495BE3857683C8A0390764EAD83845ABC|ascR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15272571], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]→[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]

2022-11-24 18:39:37

Jstuelk

37

8a3868e633778d2f68bf47d615f22f716e843294

4D6CA410A1DC104A491D3C18248CCD50CC0E983A

Biological materials
Mutant
MGNA-A172 (ytmL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/172 NBRP B. subtilis, Japan]
1A948 ( ''tcyL''::''kan''), [Pubmed|15262924], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A948&Search=1A948 BGSC]
BKE29360 ([gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACTGCTCCCTCTCTTT,  downstream forward: _UP4_TGATATATTTCTTCGGATGA
BKK29360 ([gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCACTGCTCCCTCTCTTT,  downstream forward: _UP4_TGATATATTTCTTCGGATGA
References
15262924,10092453,16109943,12193636,15668000,15272571,23944997,25848002

350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D

Page visits: 2044

Time of last update: 2022-11-29 15:59:27

Author of last update: Melvin.boenninger