

manganese transporter (proton symport)

Molecular weight
45.52 kDa
Protein length
Gene length
manganese uptake
manganese transporter (proton symport))
mntH, ydaR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1914

This gene is a member of the following regulons

491,147  492,424
Phenotypes of a mutant
suppresses the Mn2+ sensitivity of a [gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR] mutant [pubmed|31964700]
The protein
Catalyzed reaction/ biological activity
export of Mn2+
Protein family
NRAMP family (with [protein|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG], according to UniProt)
[PDB|4WGV] (from ''Staphylococcus capitis'', 40% identity) [Pubmed|25326704]
cell membrane (according to UniProt)
Expression and Regulation
repressed at high Mn(II) concentrations (MntR) [Pubmed|10760146]
regulatory mechanism
[protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]: repression, [Pubmed|10760146], in [regulon|protein:FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR regulon]
Open in new tab


2023-03-31 15:59:01





Biological materials
MGNA-C116 (ydaR::erm), available at the [ NBRP B. subtilis, Japan]
JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
BKE04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG,  downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
BKK04360 ([gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCACCTGAATTCTG,  downstream forward: _UP4_TAAAAAAACCGGCTTCTAAA
[wiki|John Helmann], Cornell University, USA [ Homepage]
Original Publications


Page visits: 3244

Time of last update: 2023-04-01 08:57:42

Author of last update: Jstuelk