SubtiWiki SubtiWiki
rtpA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

rtpA
168

anti-TRAP

locus
BSU_02530
Molecular weight
5.51 kDa
pI
4.86
Protein length
Gene length
function
regulation of tryptophan biosynthesis
product
anti-TRAP
essential
no
ec
null
synonyms
rtpA, yczA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
277,160  277,321
The protein
Structure
[PDB|1N53] (structure of T box RNA),  [PDB|2BX9], [PDB|2ZP9] (complex with [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB])
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]-[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]
description
[Pubmed|10706627]
regulation
''[protein|search|rtpA]'': induced by tryptophan limitation ([protein|search|T-box] in the mRNA leader) [Pubmed|10706627]
regulatory mechanism
T-box: transcription termination/ antitermination, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB] [pubmed|10706627], in [regulon|other_regulator:T-box|T-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10706627], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]→[gene|EAE919A6088F1A455B6FCE62BA8CCBD05C1F98D5|ycbK]

2021-12-30 16:17:16

ghost

7

aba3d4c421cab4fd6a7de94322e269e3fab0812f

2561988BA77F538C12BE51ECE1598FD4932FFB98

Biological materials
Mutant
BKE02530 ([gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGATATCCTCCTTTCT,  downstream forward: _UP4_TAAAGGAGAAAAGCTGAGCT
BKK02530 ([gene|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02530 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGATATCCTCCTTTCT,  downstream forward: _UP4_TAAAGGAGAAAAGCTGAGCT
References
Reviews
16285852,19258532
Original Publications
15213402,16306262,15099736,15743934,11786553,11566976,15023340,18178730,12386162,11557884,10706627,18334255,12855807,20713740,24682818

354C71C2F6AFE620866D90595E6AC6CEFA5705C3

Page visits: 1366

Time of last update: 2022-01-17 15:34:21

Author of last update: Bzhu