sspF

sspF
168

small acid-soluble spore protein (minor)

locus
BSU_00450
Molecular weight
6.89 kDa
pI
9.65
Protein length
Gene length
function
protection of spore DNA
product
small acid-soluble spore protein (minor)
essential
no
synonyms
sspF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5854

This gene is a member of the following regulons

Gene
Coordinates
53,183  53,368
The protein
Protein family
[wiki|Alpha/beta-type SASP family] (according to UniProt)
Structure
[AF|P37549]
Expression and Regulation
Operons
genes
[gene|358EACB735F46F7DBA2F2A132177939D80140477|sspF]
description
[Pubmed|6205155]
regulation
switched on during stage III of sporulation [Pubmed|6205155]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,6205155], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|358EACB735F46F7DBA2F2A132177939D80140477|sspF]

2022-12-13 18:30:55

ghost

13

ba24635748306a161b7505b916eb948f823742c2

A3DE4DC0846BE79F46111A3CBF01EBC0A727CDC6

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE00450 ([gene|358EACB735F46F7DBA2F2A132177939D80140477|sspF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACGAAACAACTCCTTTT,  downstream forward: _UP4_AACCGATAAGGATGTGACCC
BKK00450 ([gene|358EACB735F46F7DBA2F2A132177939D80140477|sspF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00450 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAACGAAACAACTCCTTTT,  downstream forward: _UP4_AACCGATAAGGATGTGACCC
References
Reviews
35638784
Original Publications
8982008,6205155,30782632

358EACB735F46F7DBA2F2A132177939D80140477

Page visits: 1386

Time of last update: 2023-02-06 12:16:30

Author of last update: Jstuelk