bglP

bglP
168

beta-glucoside permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIBCA of the [category|SW.1.2.2|PTS], [category|SW.3.4.3|Trigger enzyme], control of [protein|search|LicT ]activity

locus
BSU_39270
Molecular weight
64.52 kDa
pI
6.81
Protein length
Gene length
function
beta-glucoside uptake and phosphorylation, control of [protein|search|LicT ]activity
product
beta-glucoside permease of the [wiki|phosphotransferase systems|phosphotransferase system]
essential
no
ec
2.7.1.69
synonyms
bglP, sytA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2190

This gene is a member of the following regulons

Gene
Coordinates
4,033,778  4,035,607
The protein
Protein family
[category|SW.1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIA domain] type-1 (aa 480-584) (according to UniProt)
[wiki|PTS EIIB domain] type-1 (aa 1-86) (according to UniProt)
[wiki|PTS EIIC domain] type-1 (aa 103-459) (according to UniProt)
Structure
[AF|P40739]
Paralogous protein(s)
[protein|531F132F7F6A878F1E1D56977B9898A14272349A|sacX], [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP], [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP], [protein|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]
[wiki|Localization]
cell membrane [Pubmed|23475962]
Expression and Regulation
Operons
genes
[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]-[gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]
description
[Pubmed|7883710]
regulation
induced by salicin ([protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]) [Pubmed|7883710]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA] binding site overlaps -35 region) [Pubmed|7559347], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]: anti-termination, via [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-dependent [wiki|RNA switch], lack of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-dependent antitermination in the presence of gucose due to the requirement of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT] to be phosphorylated by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK], in [regulon|protein:FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7559347], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA] is predicted for '[protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]' [PubMed|20525796]
Open in new tab

[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]→[gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]

2022-11-21 17:39:42

TPed

38

3430E959FA22F9ED02C53C45C680D768C53B97DA

8A72165F04B8ECFE717CF8873DBC92B33D203CC9

Biological materials
Mutant
GP475 (erm), available in [wiki|Jörg Stülke]'s lab [pubmed|23475962]
BKE39270 ([gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATACCTCCTTTTT,  downstream forward: _UP4_TGAAAAAACTAATGGGGTGA
BKK39270 ([gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39270 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGTATACCTCCTTTTT,  downstream forward: _UP4_TGAAAAAACTAATGGGGTGA
Expression vectors
pGP1290 (C-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pGP382]), available in [wiki|Jörg Stülke]'s lab,
pGP1300 (expression of ''[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]'' in ''B. subtilis'', in [wiki|pBQ200]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP600 (in [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab
GFP fusion
GP1266, [gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-cfp, available in [wiki|Jörg Stülke]'s lab [pubmed|23475962]
References
16672620,20525796,10627040,7883710,8626332,7559347,22900538,23475962

35E6C81BE481C3E57CF47B781580368C3AC15D83

Page visits: 3906

Time of last update: 2022-11-27 03:54:56

Author of last update: Jstuelk