comEC

comEC
168

channel protein for DNA binding and uptake

locus
BSU_25570
Molecular weight
86.51 kDa
pI
6.96
Protein length
Gene length
function
genetic competence
product
DNA channel
essential
no
synonyms
comEC, comD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2333

This gene is a member of the following regulons

Gene
Coordinates
2,637,543  2,639,873
Phenotypes of a mutant
loss of [wiki|genetic competence] [pubmed|33897624]
The protein
Catalyzed reaction/ biological activity
extracellular degradation of one strand of the dsDNA and uptake of the remaining ssDNA molecule [pubmed|33772889]
[wiki|Domains]
N-terminal transmembrane DNA-transport channel
C-terminal extracellular nuclease domain [pubmed|33772889]
[wiki|Cofactors]
Mn2+ (for nuclease activity) [pubmed|33772889]
Structure
[AF|P39695]
[wiki|Localization]
cell membrane [Pubmed|15661011]
localizes to one or both cell poles [Pubmed|34928178,21278288]
Expression and Regulation
Operons
genes
[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]-[gene|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB]-[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]
description
[Pubmed|7968523,19028902]
regulatory mechanism
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, [Pubmed|8196543], in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7968523], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]→[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]

2022-11-29 06:09:41

ghost

38

86f3e687bb54836ace615fef7894da50ba4cc85a

45A6B709534D0EE24B7E982999D607F68BD6A18E

Other regulations
[protein|F21A75744FA0B25D5A251CB57E7A7DC6ABFF1DC7|comN]: unknown, [pubmed|19028902]
additional information
translation of [protein|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC] is translationally coupled to expression of [protein|954359717E15DFC106A9D8111C6637E46B16F8C9|comEB] [pubmed|33527432]
Biological materials
Mutant
GP2643 (Δ[gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]::spc) available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
BKE25570 ([gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCATCACACGTAGCTCG,  downstream forward: _UP4_TAAAAAAGACTGCCGAGAAA
BKK25570 ([gene|363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC|comEC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCATCACACGTAGCTCG,  downstream forward: _UP4_TAAAAAAGACTGCCGAGAAA
References
Reviews
15083159,31950915
Original Publications
17630974,11814663,15661011,7968523,21278288,19028902,27318187,33527432,33772889,33897624,34126763,34928178

363C6FE07C5E56FDE6BEC6ACFBA1A5535F0F64AC

Page visits: 2934

Time of last update: 2022-11-28 16:54:37

Author of last update: Jstuelk