SubtiWiki SubtiWiki
yfmP

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yfmP
168

transcription repressor ([wiki|MerR family]) of the [gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]-[gene|D91356CF66ADE0CFA9E95A686DC7355B348C8B5C|yfmO] operon

locus
BSU_07390
Molecular weight
16.36 kDa
pI
5.23
Protein length
Gene length
function
regulation of the [gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]-[gene|D91356CF66ADE0CFA9E95A686DC7355B348C8B5C|yfmO] operon
product
transcription repressor ([wiki|MerR family])
essential
no
synonyms
yfmP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0789

This gene is a member of the following regulons

Gene
Coordinates
812,140  812,562
The protein
Protein family
[wiki|MerR family]
[wiki|Domains]
[wiki|HTH merR-type domain] (aa 1-73) (according to UniProt)
Structure
[PDB|3QAO] (from Listeria monocytogenes, 29% identity)
Expression and Regulation
Operons
genes
[gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]-[gene|D91356CF66ADE0CFA9E95A686DC7355B348C8B5C|yfmO]
description
[Pubmed|14663075]
regulatory mechanism
[protein|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]: repression, [Pubmed|14663075], in [regulon|protein:36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|14663075], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]→[gene|D91356CF66ADE0CFA9E95A686DC7355B348C8B5C|yfmO]

2021-12-07 20:14:27

ghost

3

9f50834fac7c77dfac6e7a97566a75709031480a

67047AC80B3796BC1FC3CD44C823D5074123B880

Biological materials
Mutant
MGNA-C236 (yfmP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2234 NBRP B. subtilis, Japan]
BKE07390 ([gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGGTAAATCCCCCTTCGC,  downstream forward: _UP4_TGAAAAGTTTGTTAAACGCT
BKK07390 ([gene|36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1|yfmP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07390 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGGTAAATCCCCCTTCGC,  downstream forward: _UP4_TGAAAAGTTTGTTAAACGCT
References
14663075

36AF02B4EB416ABCA3F0E4C5A4126E777A20C7D1

Page visits: 1056

Time of last update: 2021-12-03 15:26:05

Author of last update: Melvin.boenninger