ycbF

ycbF
168

glucarate dehydratase

locus
BSU_02490
Molecular weight
50.62 kDa
pI
5.59
Protein length
Gene length
function
glucarate utilization
product
glucarate dehydratase
essential
no
ec
4.2.1.40
synonyms
ycbF, gudD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4948

This gene is a member of the following regulons

Gene
Coordinates
271,800  273,167
The protein
Catalyzed reaction/ biological activity
D-glucarate --> 5-dehydro-4-deoxy-D-glucarate + H2O (according to UniProt)
Protein family
[wiki|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
Structure
[PDB|1EC7] (from E. coli, 73% identity) [pubmed|10769114]
[AF|P42238]
Expression and Regulation
Operons
genes
[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
description
[Pubmed|12044674]
regulation
induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
regulatory mechanism
[protein|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]: repression, [Pubmed|12044674], in [regulon|protein:1A65880F68898002EE8774F34EDC47F0243B7273|ycbG regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]→[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]

2022-11-27 13:24:43

ghost

38

a8e395a36da4d417bafa3e16f332fbbf2dcf2e61

24EBFC92FB6A93BD115AC81FF68694FB539EE76E

Biological materials
Mutant
MGNA-C029 (ycbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2027 NBRP B. subtilis, Japan]
BKE02490 ([gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCATTTTCCTCCCTTTA,  downstream forward: _UP4_TAAGTTTGATTGTAAATATT
BKK02490 ([gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCATTTTCCTCCCTTTA,  downstream forward: _UP4_TAAGTTTGATTGTAAATATT
References
12044674,10769114

372F2A420309DB0193AEF36A740EBA26410F97F2

Page visits: 1019

Time of last update: 2022-11-30 17:20:00

Author of last update: Melvin.boenninger