ycbF
168
glucarate dehydratase
locus
BSU_02490
Molecular weight
50.62 kDa
pI
5.59
function
glucarate utilization
product
glucarate dehydratase
essential
no
ec
4.2.1.40
synonyms
ycbF, gudD
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG4948 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
271,800 273,167
The protein
Catalyzed reaction/ biological activity
D-glucarate --> 5-dehydro-4-deoxy-D-glucarate + H2O (according to UniProt)
Protein family
[wiki|mandelate racemase/muconate lactonizing enzyme family] (according to UniProt)
Structure
[PDB|1EC7] (from E. coli, 73% identity) [pubmed|10769114]
[AF|P42238]
Expression and Regulation
Operons
genes
[gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
description
[Pubmed|12044674]
regulation
induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
regulatory mechanism
[protein|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]: repression, [Pubmed|12044674], in [regulon|protein:1A65880F68898002EE8774F34EDC47F0243B7273|ycbG regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18840696], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Biological materials
Mutant
MGNA-C029 (ycbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2027 NBRP B. subtilis, Japan]
BKE02490 ([gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCATTTTCCTCCCTTTA, downstream forward: _UP4_TAAGTTTGATTGTAAATATT
BKK02490 ([gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCATTTTCCTCCCTTTA, downstream forward: _UP4_TAAGTTTGATTGTAAATATT
References
Page visits: 2828
Time of last update: 2025-10-28 20:02:43
Author of last update: Melvin.boenninger