SubtiWiki SubtiWiki
ycdA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ycdA
168

lipoprotein, required for swarming motility

locus
BSU_02780
Molecular weight
39.02 kDa
pI
4.71
Protein length
Gene length
function
swarming motility
product
lipoprotein
essential
no
synonyms
ycdA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
299,438  300,502
Phenotypes of a mutant
reduced swarming motility [Pubmed|22496484]
The protein
[wiki|Domains]
[wiki|DUF4352] (aa 39 ... 148) (according to UniProt)
DUF5105 (aa 164 ... 352) (according to UniProt)
Structure
[PDB|4R4G]
[wiki|Localization]
lipoprotein [Pubmed|22496484]
membrane associated [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]
description
[Pubmed|22496484]
regulation
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|22496484], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]: activation, in [regulon|protein:0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2 regulon]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: repression, in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of ''ycdA'' [Pubmed|27120414]
Open in new tab

[gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]

2022-01-25 21:47:48

Jstuelk

17

CA4422290FB117321B6D380851E558F5A6A76B16

7CA3EAACAA410D7AF7E5FC8DCAD44129CFC190CC

Biological materials
Mutant
MGNA-B978 (ycdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1977 NBRP B. subtilis, Japan]
BKE02780 ([gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTCCTCCTCAA,  downstream forward: _UP4_TAAAACACCAAAAGGAAATA
BKK02780 ([gene|3801FD18D7B59C0461FA0834AB1412F95C325B9C|ycdA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02780 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTCCTCCTCAA,  downstream forward: _UP4_TAAAACACCAAAAGGAAATA
References
18763711,20817675,20525796,22496484,27120414,33782055

3801FD18D7B59C0461FA0834AB1412F95C325B9C

Page visits: 2143

Time of last update: 2022-01-27 14:46:49

Author of last update: Jstuelk