SubtiWiki SubtiWiki
glcD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

glcD
168

probably glycolate oxidase subunit, FAD-binding

locus
BSU_28680
Molecular weight
50.77 kDa
pI
4.86
Protein length
Gene length
function
unknown
product
probably glycolate oxidase subunit
essential
no
ec
1.1.3.15
synonyms
glcD, ysfC, glcD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0277

This gene is a member of the following regulons

Gene
Coordinates
2,933,185  2,934,597
The protein
Protein family
FAD-binding oxidoreductase/transferase type 4 family (single member, according to UniProt)
[wiki|Domains]
[wiki|FAD-binding PCMH-type domain] (aa 37-216) (according to UniProt)
[wiki|Cofactors]
FAD (acording to UniProt)
Structure
[PDB|3PM9] (dehydrogenase from Rhodopseudomonas palustris, 32% identity)
Additional information
The gene is annotated in KEGG as an ortholog of (S)-2-hydroxy-acid oxidase EC 1.1.3.15. No EC annotation is available in Swiss-Prot. In MetaCyc, it is annotated as similar to glycolate oxidase subunit. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
Expression and Regulation
Operons
genes
[gene|386BB8A42AF9FEB27FA3CABEDA21AA153A544316|glcD]-[gene|DDD01D9C50BC11A50D263946ECA15CB58570ACAA|glcF]
description
[Pubmed|22383849]
Open in new tab

[gene|386BB8A42AF9FEB27FA3CABEDA21AA153A544316|glcD]→[gene|DDD01D9C50BC11A50D263946ECA15CB58570ACAA|glcF]

2022-01-21 11:59:28

Jstuelk

2

abd977a1d88f08327ef1b74031e16bb810b01e81

D261C26D13820F647CC0176848B9455846586320

Biological materials
Mutant
MGNA-B001 (ysfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1000 NBRP B. subtilis, Japan]
BKE28680 ([gene|386BB8A42AF9FEB27FA3CABEDA21AA153A544316|glcD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCCATCCCCCTGT,  downstream forward: _UP4_AGAAAACGTGTGGTGGCGGA
BKK28680 ([gene|386BB8A42AF9FEB27FA3CABEDA21AA153A544316|glcD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28680 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCCATCCCCCTGT,  downstream forward: _UP4_AGAAAACGTGTGGTGGCGGA
References
Research papers
27264531,8606183

386BB8A42AF9FEB27FA3CABEDA21AA153A544316

Page visits: 789

Time of last update: 2022-01-26 11:27:15

Author of last update: Melvin.boenninger