exoA

exoA
168

apurinic/apyrimidinic endonuclease, multifunctional DNA-repair enzyme, important for spore dormance

locus
BSU_40880
Molecular weight
29.10 kDa
pI
4.59
Protein length
Gene length
function
repair of oxidative DNA damage in spores
product
apurinic/apyrimidinic endonuclease
essential
no
synonyms
exoA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0708

This gene is a member of the following regulons

Gene
Coordinates
4,197,780  4,198,538
Phenotypes of a mutant
reduced formation of [gene|F1969E4C7BAAF70BCBE570F58350C12A3E417539|rpsB] or [gene|144D952B05EBBFF41EC92DF906543EA00475FE69|rpsE] suppressor mutants after mitomycin treatment [pubmed|34339280]
an ''[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]'' double mutant is impaired in germination and spore outgrowth due to the accumulation of DNA lesions, this can be rescued by inactivation of ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]'' [Pubmed|24244006]
an ''[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]'' double mutant is sensitive to radiation [Pubmed|24123749]
sensitive to blue light-induced DNA damage [pubmed|30054368]
reduced resistance towards electron beams [pubmed|31948638]
The protein
Catalyzed reaction/ biological activity
Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
Protein family
DNA repair enzymes AP/ExoA family (single member, according to UniProt)
Structure
[PDB|5CFE] [Pubmed|27343627]
[AF|P37454]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]-[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]
description
(according to [http://dbtbs.hgc.jp/COG/prom/exoA-ccpA.html DBTBS]) null
regulation
expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16237020]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16237020], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]→[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]

2022-12-29 22:40:47

ghost

50

3f181edb20420bd1cb614f6c4de3ba54858fe866

B6BAB0747C1B7BA1C01E54A6AE82AD107F48CAD3

Biological materials
Mutant
GP898 (Δ[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]::''kan''), available in [wiki|Jörg Stülke]'s lab [pubmed|22178973]
GP1503 (Δ[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]::''kan'' [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]::''cat''), available in [wiki|Jörg Stülke]'s lab [pubmed|22178973]
BKE40880 (Δ[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT,  downstream forward: _UP4_TGATGAGATAGCAGTAAGGA
BKK40880 (Δ[gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40880 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT,  downstream forward: _UP4_TGATGAGATAGCAGTAAGGA
References
Reviews
22933559
Original Publications
24244006,18203828,16237020,19930460,10540738,21441501,24123749,24123749,24914186,27343627,30054368,30726292,31948638,34339280

38CC84343C47CBF37F007E9056A9248869C396E1

Page visits: 1391

Time of last update: 2023-02-04 21:50:24

Author of last update: Jstuelk