ylmB

ylmB
168

N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase, thiamine salvage pathway

locus
BSU_15350
Molecular weight
47.02 kDa
pI
4.98
Protein length
Gene length
function
thiamine salvage
product
N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine deformylase
essential
no
synonyms
ylmB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0624

This gene is a member of the following regulons

Gene
Coordinates
1,607,556  1,608,836
The protein
Catalyzed reaction/ biological activity
H2O + N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine --> 4-amino-5-aminomethyl-2-methylpyrimidine + formate (according to UniProt)
Protein family
[wiki|peptidase M20A family] (according to UniProt)
[wiki|Cofactors]
Binds 2 zinc or cobalt ions per subunit (according to Swiss-Prot)
Structure
[PDB|3PFO] (from Rhodopseudomonas palustris, 25% identity)
[AF|O31724]
Paralogous protein(s)
[protein|161ADC907D4902001C8751F51CFA762828C26110|yodQ]
Expression and Regulation
Operons
genes
[gene|392921E3C53846236DF75D7585697969B11AF2F3|ylmB]
description
[pubmed|22383849]
regulatory mechanism
[protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: RNA switch, antitermination via [wiki|RNA switch], in [regulon|protein:E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
Open in new tab

[gene|392921E3C53846236DF75D7585697969B11AF2F3|ylmB]

2022-11-26 01:54:01

Jstuelk

24

eb1bd6149c87939790dcca836b55754c23c7618e

672F2266806F302505E82A023D8EC8575EC8A721

Biological materials
Mutant
MGNA-B124 (ylmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1123 NBRP B. subtilis, Japan]
BKE15350 ([gene|392921E3C53846236DF75D7585697969B11AF2F3|ylmB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTAAATCCGCTCCTAT,  downstream forward: _UP4_TGACATGAAAATTTCTTCTT
BKK15350 ([gene|392921E3C53846236DF75D7585697969B11AF2F3|ylmB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTAAATCCGCTCCTAT,  downstream forward: _UP4_TGACATGAAAATTTCTTCTT
References
17618314,12376536,28516784,29794222

392921E3C53846236DF75D7585697969B11AF2F3

Page visits: 2222

Time of last update: 2022-12-01 09:07:03

Author of last update: Melvin.boenninger