ycxD

ycxD
168

similar to transcriptional regulator ([wiki|MocR/ GabR family])

locus
BSU_03560
Molecular weight
50.59 kDa
pI
8.57
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ycxD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1167

This gene is a member of the following regulons

Gene
Coordinates
406,131  407,465
The protein
Protein family
[wiki|MocR/ GabR family] [Pubmed|22020104]
[wiki|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Domains]
N-terminal DNA-binding helix-turn-helix motif; C-terminal domain is homologous to PLP-binding large domain of aminotransferases.
[wiki|HTH gntR-type domain] (aa 1-69) (according to UniProt)
[wiki|Cofactors]
PLP
Structure
[PDB|4MGR] ([protein|C7C36FAC0CE72226960FC7E8E016B8EC77AF1036|gabR], 27% identity) [pubmed|24127574]
[AF|Q08792]
Biological materials
Mutant
BKE03560 ([gene|3A756A845ADA88DA569FA9A1B484DA43A28C6F4D|ycxD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTCTCCCCCTGTTT,  downstream forward: _UP4_GGTGTCAAGCTGTTGATGAG
BKK03560 ([gene|3A756A845ADA88DA569FA9A1B484DA43A28C6F4D|ycxD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCTTCTCCCCCTGTTT,  downstream forward: _UP4_GGTGTCAAGCTGTTGATGAG
References
11756427,22020104,24127574

3A756A845ADA88DA569FA9A1B484DA43A28C6F4D

Page visits: 1106

Time of last update: 2022-11-27 12:32:35

Author of last update: Melvin.boenninger