SubtiWiki SubtiWiki
yceH

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yceH
168

similar to toxic anion resistance protein

locus
BSU_02940
Molecular weight
41.51 kDa
pI
5.75
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yceH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3853

This gene is a member of the following regulons

Gene
Coordinates
316,512  317,603
Phenotypes of a mutant
more sensitive to nisin [Pubmed|23980836]
The protein
Protein family
TelA family (with [protein|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN], according to UniProt)
Paralogous protein(s)
[protein|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN]
Expression and Regulation
Operons
genes
[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
description
[Pubmed|11866510]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|19047346], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]→[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]

2022-01-24 04:05:22

ghost

6

1557da8d91643a69a9cc817172bc649767baab90

35ADA58FA11FB35C1D0420A579F4F2F0CD877167

Biological materials
Mutant
BKE02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT,  downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
BKK02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT,  downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
GP644 (''[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]''::''kan'' trpC2), available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
11544224,11866510,18179421,23980836

3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF

Page visits: 1422

Time of last update: 2022-01-25 08:48:15

Author of last update: LKrueger