

similar to toxic anion resistance protein

Molecular weight
41.51 kDa
Protein length
Gene length

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3853

This gene is a member of the following regulons

316,512  317,603
Phenotypes of a mutant
more sensitive to nisin [Pubmed|23980836]
The protein
Protein family
TelA family (with [protein|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|yaaN], according to UniProt)
Paralogous protein(s)
Expression and Regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|19047346], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab


2022-11-15 20:00:54





Biological materials
BKE02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT,  downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
BKK02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02940 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT,  downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
GP644 (''[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]''::''kan'' trpC2), available in [wiki|Jörg Stülke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab


Page visits: 2006

Time of last update: 2022-12-02 15:48:27

Author of last update: LKrueger