yveA

yveA
168

similar to aspartate/ glutamate transporter

locus
BSU_34470
Molecular weight
56.82 kDa
pI
9.68
Protein length
Gene length
function
unknown
product
similar to aspartate/ glutamate transporter
essential
no
synonyms
yveA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0531

This gene is a member of the following regulons

Gene
Coordinates
3,539,165  3,540,727
The protein
Protein family
[wiki|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
Structure
[PDB|5OQT] (YneM from E. coli, 28% identity) [pubmed|29416041]
[AF|O07002]
Paralogous protein(s)
[protein|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]
[wiki|Localization]
cell membrane (according to UniProt)
Additional information
the protein has been annotated as aspartate transporter. It is, however, not implicated in aspartate uptake in exponentially growing cells [Pubmed|25344233]
Expression and Regulation
Operons
genes
[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]
description
[Pubmed|16497325]
regulation
expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]) [Pubmed|16497325]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|2428811], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|16497325], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]

2022-11-14 21:56:28

Jstuelk

21

3b52673df39a4e6bab711a23ee2ec2f5099f6197

5446A94479929212041B90943007B964F6B543B2

Biological materials
Mutant
GP2385 ∆[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::''cat'', available in [wiki|Jörg Stülke]'s lab
GP2795 ∆[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::''spec'', available in [wiki|Jörg Stülke]'s lab
GP2822 ∆[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::''neo'', available in [wiki|Jörg Stülke]'s lab
GP4154 (Δ[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]::''kan'') (Δ[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::''cat''), available in [wiki|Jörg Stülke]'s lab
BKE34470 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA,  downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
BKK34470 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA,  downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
MDB43 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::neo trpC2 pheA1 available in [wiki|Erhard Bremer]'s and [wiki|Jörg Stülke]'s labs [Pubmed|25344233]
MGNA-B615 (yveA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1614 NBRP B. subtilis, Japan]
References
12730183,11739774,2428811,3039303,16497325,25344233,29416041

3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB

Page visits: 2637

Time of last update: 2022-11-29 16:29:05

Author of last update: Jstuelk