ythQ

ythQ
168

similar to [wiki|ABC transporter] (membrane protein)

locus
BSU_30000
Molecular weight
44.89 kDa
pI
10.04
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (membrane protein)
essential
no
synonyms
ythQ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4473

This gene is a member of the following regulons

Gene
Coordinates
3,070,246  3,071,403
The protein
Structure
[AF|O35029]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|47C1A154AF6F67CA507A9F4FEA9576E7131EFB6D|ythP]-[gene|3ACDFBD5615510FA015486C7A3C7023226EC3476|ythQ]
description
[Pubmed|11866510]
regulation
expressed under conditions of cell wall stress ([protein|search|SigW]) [Pubmed|11866510,12207695]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|47C1A154AF6F67CA507A9F4FEA9576E7131EFB6D|ythP]→[gene|3ACDFBD5615510FA015486C7A3C7023226EC3476|ythQ]

2022-12-01 16:48:52

ghost

17

8135449d7cd396e47f24f9dcf83f2bb90e08a6ed

50644D17F5230BD3D9806F8452203580685A1923

Biological materials
Mutant
MGNA-A818 (ythQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/818 NBRP B. subtilis, Japan]
BKE30000 ([gene|3ACDFBD5615510FA015486C7A3C7023226EC3476|ythQ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE30000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCGAAAAAAGAGCGTACGCC,  downstream forward: _UP4_TAAAAAACCCAAACGGCGAC
BKK30000 ([gene|3ACDFBD5615510FA015486C7A3C7023226EC3476|ythQ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK30000 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCGAAAAAAGAGCGTACGCC,  downstream forward: _UP4_TAAAAAACCCAAACGGCGAC
References
10092453,11866510,12207695

3ACDFBD5615510FA015486C7A3C7023226EC3476

Page visits: 1422

Time of last update: 2022-12-06 09:29:06

Author of last update: Melvin.boenninger