phrG

phrG
168

response regulator aspartate phosphatase (RapG) regulator

locus
BSU_40310
Molecular weight
4.04 kDa
pI
9.02
Protein length
Gene length
function
control of DegU activity
product
phosphatase (RapG) regulator
essential
no
ec
null
synonyms
phrG, yycL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,141,358  4,141,474
The protein
Catalyzed reaction/ biological activity
binds to [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG], this results in the inability of [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG] to interact with [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] [Pubmed|12950930]
Protein family
[wiki|phr family] (according to UniProt)
Structure
[AF|O32295]
Expression and Regulation
Operons
genes
[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]-[gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]
description
[Pubmed|12950930]
regulation
repressed by glucose (4.8-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]: repression, [Pubmed|16553878], in [regulon|protein:972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16553878], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|12950930], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]→[gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]

2022-09-24 18:57:40

ghost

30

e49c87eec067b5c485c5a9eb9803177ba906bdbf

B07F03B9D46149465A5E6BF2E71700DEE720BCBE

Biological materials
Mutant
MGNA-B822 (yycL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1821 NBRP B. subtilis, Japan]
BKE40310 ([gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCGCCAATCAGAAATCTTT,  downstream forward: _UP4_TAAATGAAAAACCCCCGCGG
BKK40310 ([gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40310 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGCGCCAATCAGAAATCTTT,  downstream forward: _UP4_TAAATGAAAAACCCCCGCGG
References
16553878,12850135,12950930

3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5

Page visits: 1521

Time of last update: 2022-10-06 04:57:20

Author of last update: Melvin.boenninger