odhA

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

odhA
168

2-oxoglutarate dehydrogenase (E1 subunit)

locus
BSU_19370
Molecular weight
105.54 kDa
pI
5.87
Protein length
Gene length
function
TCA cycle
product
2-oxoglutarate dehydrogenase (E1 subunit)
essential
no
ec
1.2.4.2
synonyms
odhA, citK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0567

This gene is a member of the following regulons

Gene
Coordinates
2,108,774  2,111,608
The protein
Catalyzed reaction/ biological activity
2-oxoglutarate + [dihydrolipoyllysine-residue succinyltransferase]-(R)-N6-lipoyl-L-lysine + H+ --> [dihydrolipoyllysine-residue succinyltransferase]-(R)-N6-(S8-succinyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)
Protein family
alpha-ketoglutarate dehydrogenase family (single member, according to UniProt)
Structure
[PDB|2JGD] (from ''Escherichia coli'', 38% identity, 55% similarity) [Pubmed|17367808]
[AF|P23129]
Modification
phosphorylated on Arg-66 and Arg-621 [Pubmed|22517742]
[wiki|Localization]
cytoplasm (according to UniProt)
Additional information
extensive information on the structure and enzymatic properties of 2-oxoglutarate dehydrogenase can be found at [http://www.proteopedia.org/wiki/index.php/2-Oxoglutarate_Dehydrogenase Proteopedia]
Expression and Regulation
Operons
genes
[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]
description
[Pubmed|11976317]
regulation
repressed by glucose (2.4-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1508153], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]→[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]

2022-05-25 18:15:23

ghost

16

998628ac6a5b555702d5fa0febcedb0378ac763b

87DE9AE10510310314B50140AE66E41B4448BC3A

Biological materials
Mutant
GP671 (spc), GP684 (cat), available in [wiki|Jörg Stülke]'s lab
GP1274 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA])::''cat'', available in [wiki|Jörg Stülke]'s lab
GP1276 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''cat'', available in [wiki|Jörg Stülke]'s lab
GP2183 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA])::''ermC'', available in [wiki|Jörg Stülke]'s lab [pubmed|28679749]
GP2332 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
GP2334 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
BKE19370 ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATATTACCCCCAA,  downstream forward: _UP4_AAAAACTAAGGGGGAAATGA
BKK19370 ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATATTACCCCCAA,  downstream forward: _UP4_AAAAACTAAGGGGGAAATGA
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP3106 (in [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
10672230
Original Publications
2500417,20933603,1508153,11976317,12850135,22517742,22900538,24263382

3B54AD8514709655BA829347B7BD5B38EF7C08ED

Page visits: 2755

Time of last update: 2022-05-25 19:23:52

Author of last update: Melvin.boenninger